ID: 1068612307

View in Genome Browser
Species Human (GRCh38)
Location 10:59073611-59073633
Sequence TCCCACAGGGTGATGCAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068612299_1068612307 21 Left 1068612299 10:59073567-59073589 CCAGAGGATCAGCATTTTATTGT No data
Right 1068612307 10:59073611-59073633 TCCCACAGGGTGATGCAAAAAGG No data
1068612302_1068612307 -10 Left 1068612302 10:59073598-59073620 CCTGAGCCCCAATTCCCACAGGG No data
Right 1068612307 10:59073611-59073633 TCCCACAGGGTGATGCAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068612307 Original CRISPR TCCCACAGGGTGATGCAAAA AGG Intergenic
No off target data available for this crispr