ID: 1068614029

View in Genome Browser
Species Human (GRCh38)
Location 10:59091884-59091906
Sequence GTGCTGTTATTGTTGGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068614026_1068614029 28 Left 1068614026 10:59091833-59091855 CCAAATTTAGTTTGTAATTTATA No data
Right 1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG No data
1068614025_1068614029 29 Left 1068614025 10:59091832-59091854 CCCAAATTTAGTTTGTAATTTAT No data
Right 1068614029 10:59091884-59091906 GTGCTGTTATTGTTGGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068614029 Original CRISPR GTGCTGTTATTGTTGGAGCA AGG Intergenic
No off target data available for this crispr