ID: 1068628872

View in Genome Browser
Species Human (GRCh38)
Location 10:59279103-59279125
Sequence CAGTAATACTTTATAGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 221}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068628872_1068628874 6 Left 1068628872 10:59279103-59279125 CCGTGTTCTATAAAGTATTACTG 0: 1
1: 0
2: 1
3: 11
4: 221
Right 1068628874 10:59279132-59279154 CTTGCACTTCAGAATCATCAAGG No data
1068628872_1068628876 24 Left 1068628872 10:59279103-59279125 CCGTGTTCTATAAAGTATTACTG 0: 1
1: 0
2: 1
3: 11
4: 221
Right 1068628876 10:59279150-59279172 CAAGGGAGTTTTTCAAATGTAGG No data
1068628872_1068628875 7 Left 1068628872 10:59279103-59279125 CCGTGTTCTATAAAGTATTACTG 0: 1
1: 0
2: 1
3: 11
4: 221
Right 1068628875 10:59279133-59279155 TTGCACTTCAGAATCATCAAGGG No data
1068628872_1068628877 25 Left 1068628872 10:59279103-59279125 CCGTGTTCTATAAAGTATTACTG 0: 1
1: 0
2: 1
3: 11
4: 221
Right 1068628877 10:59279151-59279173 AAGGGAGTTTTTCAAATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068628872 Original CRISPR CAGTAATACTTTATAGAACA CGG (reversed) Intronic
900734876 1:4293074-4293096 CAGTGTTATTTTGTAGAACATGG + Intergenic
902713401 1:18256015-18256037 CTGTAATGCTTTGTAGGACATGG - Intronic
903101990 1:21038035-21038057 CAGTGATACTATATGGAGCAGGG + Intronic
905754045 1:40492556-40492578 CAGAACAACTTTAAAGAACAAGG - Intronic
907000839 1:50853943-50853965 CAGAAATACTTCATATATCATGG + Intronic
907935628 1:59039586-59039608 CAGCACTAATTTGTAGAACAAGG + Intergenic
909954404 1:81760792-81760814 CAGAAATACTTTATTTTACATGG - Intronic
910170831 1:84375075-84375097 CAGTAAGACTTTGTGAAACATGG - Intronic
913377294 1:118166516-118166538 CAGTAAAACTTAAAAGCACAGGG + Intronic
916453830 1:164949717-164949739 CCCTTATACTTTATATAACAGGG - Intergenic
917056761 1:170991028-170991050 CAGTAATACTTTACACAAAGTGG - Intronic
917065222 1:171085503-171085525 CAGTAACACTTTATAACAAAAGG - Intergenic
918565760 1:185929957-185929979 CAGCAATACTTTTTAGGAGAAGG + Intronic
919630668 1:199957406-199957428 CAGTAATAATATAGAGAAGAAGG - Intergenic
921693199 1:218176992-218177014 CAGCAATACTTAAAAAAACATGG - Intergenic
923221396 1:231897445-231897467 CAGTTATCATTTATGGAACAAGG + Intronic
924746542 1:246839823-246839845 CAGTTGTACTGTAGAGAACAGGG + Exonic
1063153829 10:3360102-3360124 CAGTCATCCTTTAAACAACAGGG + Intergenic
1064805863 10:19131473-19131495 GAGTATTATTTTATAGATCATGG - Intronic
1065168258 10:23003102-23003124 CAGTATTACTTTATCTAAGAGGG + Intronic
1065457424 10:25921916-25921938 CAGTTATACTTTATAGAGCATGG - Intergenic
1067215473 10:44299075-44299097 GGATAATATTTTATAGAACAGGG - Intergenic
1067792281 10:49297403-49297425 CAACAATACTTAATAGATCATGG - Intergenic
1068311382 10:55280838-55280860 CATTAATATTTCATAGCACATGG - Intronic
1068350793 10:55842483-55842505 TATTAATACTTTAAAGATCAAGG + Intergenic
1068628872 10:59279103-59279125 CAGTAATACTTTATAGAACACGG - Intronic
1069292617 10:66800421-66800443 CAGCAATACTTTAAAAATCAAGG + Intronic
1070699969 10:78594784-78594806 CTGTCATATTTTATAGCACAAGG + Intergenic
1071135760 10:82452172-82452194 CATTATGAGTTTATAGAACAAGG - Intronic
1071339024 10:84625587-84625609 CAGTAATAATCTTAAGAACACGG - Intergenic
1072210841 10:93245803-93245825 CAGAAATAATTTAAAGAACAAGG - Intergenic
1073996308 10:109318926-109318948 AAGTAAGACATTATATAACAAGG + Intergenic
1075923032 10:126228894-126228916 CAGTAAGATTTTATAGATTAAGG + Intronic
1078797568 11:14608050-14608072 CAATAATAGTGTATATAACAAGG + Intronic
1078954234 11:16172003-16172025 CAGTTATGCTTTCTAGAACTGGG - Intronic
1079161690 11:18000960-18000982 CAGTAAGACTTTATTTACCAAGG + Intronic
1079226357 11:18609018-18609040 GAGTAATAGTTTATAAAATAAGG - Exonic
1079946511 11:26749292-26749314 CTGAAATTCTTTCTAGAACAAGG + Intergenic
1080880562 11:36316239-36316261 CAATAAAACTTTATAGAAACAGG + Intronic
1080957892 11:37122652-37122674 CAGTAGAATTTTATAGAACTAGG + Intergenic
1081790230 11:45777589-45777611 TAATAATACTTGATAAAACAGGG + Intergenic
1086206430 11:84263628-84263650 GAGTTATACCTTATAGAAAATGG - Intronic
1090096171 11:123743587-123743609 CAGTGATACTTGTTAGAGCATGG + Intergenic
1090613441 11:128492791-128492813 CAGTTTTACTTTAGAGAAAAGGG + Intronic
1091236472 11:134025514-134025536 CAATCATCCTCTATAGAACATGG + Intergenic
1093288340 12:17294212-17294234 AAGTAATACTTTAAAAAACAGGG + Intergenic
1093699340 12:22201337-22201359 ATGAAATACTTTATAGCACATGG - Exonic
1094769574 12:33638409-33638431 AAGTAGGACTTTATAGATCAAGG + Intergenic
1095955701 12:47804565-47804587 CAGGAATACTGTCTAGCACAGGG + Intronic
1097379567 12:58878685-58878707 CATTAATACTTTCTAGGAAAAGG + Intronic
1099320118 12:81136403-81136425 CAATAATATTTTATAGAAACAGG + Intronic
1099553290 12:84075062-84075084 AAGAAATACTTTATACACCATGG + Intergenic
1099942300 12:89203056-89203078 CAGTAATATTTTTTAAAACTAGG - Intergenic
1100134758 12:91541984-91542006 CAGTAATGGTTTATAGTAAATGG - Intergenic
1102355251 12:112228918-112228940 CAGTAATAGTTTATACTACTAGG + Intronic
1102656508 12:114486356-114486378 CAGTGATACTTGCAAGAACATGG - Intergenic
1103851233 12:123934845-123934867 CAGTCCTACTTTTTAAAACAGGG + Exonic
1104640922 12:130466461-130466483 CATTCATTCTTTAGAGAACAGGG + Intronic
1105467633 13:20660951-20660973 CAGTAATACTTTTGAAAAAATGG + Intronic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1108157529 13:47601404-47601426 CACTTATACTTTTTAGAGCATGG + Intergenic
1110237140 13:73228606-73228628 CAGGAATTTTCTATAGAACAAGG - Intergenic
1110514924 13:76399064-76399086 CAGTAACACTTTGCAGAATAAGG + Intergenic
1110984636 13:81951056-81951078 CATTAATAATGTATATAACATGG - Intergenic
1111073355 13:83199711-83199733 CAGGAACACTTGATAGAAGAGGG + Intergenic
1111754273 13:92372880-92372902 CTGTATTATGTTATAGAACAAGG + Intronic
1114315626 14:21507352-21507374 CAGTAATGCTGTAAAAAACAAGG + Intronic
1114377554 14:22164559-22164581 CAGTAATACTTGTTAAAACACGG + Intergenic
1114949401 14:27729765-27729787 TACTAATAATTTACAGAACATGG + Intergenic
1115896150 14:38089887-38089909 CAGTAATACTCTATAGAGGCAGG + Intergenic
1115902170 14:38163978-38164000 CAGTAAGTCTTTTTAGAAAATGG - Intergenic
1116091412 14:40311636-40311658 CAGTAATACTTCATTTAACAAGG - Intergenic
1116946348 14:50838824-50838846 CAGAAATTCTTTCTAGAACAAGG - Intergenic
1118108142 14:62684370-62684392 AAGGAAAACTTTATAGAAAAAGG + Intergenic
1119624518 14:76160756-76160778 CAGTAAATTTTTAAAGAACATGG - Intronic
1120318145 14:82923047-82923069 CAGTAATAACTTATATTACAGGG - Intergenic
1120642086 14:87027815-87027837 CAGTTAAAATTTACAGAACAGGG + Intergenic
1123819050 15:24008346-24008368 CTGAAATATTTTAAAGAACAAGG - Intergenic
1125988949 15:44086395-44086417 TATTAATACTTGATACAACATGG + Intronic
1132267675 15:100489549-100489571 TAGTAATACTTTGTATAAAATGG - Intronic
1136612338 16:31373888-31373910 CAGTAAAACTTTATAAAAATAGG + Intronic
1141262207 16:82464060-82464082 CAGGAACAGTTTATAGGACAGGG - Intergenic
1141820888 16:86444644-86444666 CAGAAATACTCAATAGGACATGG - Intergenic
1147054244 17:37822164-37822186 TAGTAATACATTCTATAACATGG - Intergenic
1147618891 17:41849601-41849623 CAGAAATACTATATAAAACCGGG + Intergenic
1149719161 17:58825880-58825902 TAGTAAAACTATATAGAATAAGG - Intronic
1151277438 17:73046259-73046281 ATGTAATACTATTTAGAACAAGG - Intronic
1156168528 18:34453837-34453859 CATTATTATTTTATAGATCATGG - Intergenic
1156305089 18:35871601-35871623 CAGGAATACTTATGAGAACATGG - Intergenic
1160322697 18:77911374-77911396 TAGAAATCCTTTATAGATCAGGG - Intergenic
1161709479 19:5839819-5839841 CAGAAATGATTTCTAGAACAGGG - Intergenic
1162852333 19:13440361-13440383 CAGCAGTACTTTATAGAAAGGGG + Intronic
1163890995 19:20013406-20013428 CAGTAATAAGTTATAAAGCAAGG + Intronic
925367141 2:3318225-3318247 CAGTAAGACTGTAAAGAACCGGG - Intronic
925468937 2:4138184-4138206 CAGTAATACTATAAAGTACAAGG + Intergenic
925735701 2:6961772-6961794 CAGGAATACTTCATGGAAGAAGG - Intronic
926676227 2:15623555-15623577 GAGCAGTACTTTATACAACAAGG + Exonic
927234115 2:20854485-20854507 CAGAAATACTTTATAAACAAGGG - Intergenic
931284035 2:60817820-60817842 CATTACTACTTTCTAGAGCAGGG + Intergenic
934135383 2:88991520-88991542 AATTAAGACTTTATATAACAGGG - Intergenic
935113515 2:100113597-100113619 AGGTAATACGTTATAGTACACGG - Intronic
936718656 2:115221798-115221820 CAGAAATATCTTATAGACCATGG - Intronic
937162100 2:119773963-119773985 CAGTAATACATTATGTAAGATGG - Intronic
938446296 2:131382368-131382390 CAGAAATAATGTATAGAACCAGG + Intergenic
938667415 2:133552956-133552978 CAGTAAAACTTTTTAAAACTTGG - Intronic
939190124 2:138907570-138907592 AAATAATACTTTAATGAACATGG + Intergenic
941118454 2:161499902-161499924 CAGTTGTACTGTAGAGAACAGGG + Intronic
941688700 2:168475582-168475604 CAGTAATAGTTTAGTGAAAAAGG + Intronic
941758891 2:169219121-169219143 CAGTTATTCTTTCTAGAAGAAGG - Intronic
942897262 2:181072090-181072112 CAATAATATTCTTTAGAACACGG + Intronic
943546132 2:189281308-189281330 CAGTAAGAGTTTAAAGAACTTGG + Intergenic
945012176 2:205477168-205477190 CAGTCCCACTTTATATAACATGG + Intronic
946540886 2:220683419-220683441 AAGTAATAATTTATAGTAAAGGG + Intergenic
947532322 2:230918523-230918545 CTGAAATACTTTATAGGGCACGG - Intronic
1170105409 20:12750149-12750171 CAGTAGCAATTTATTGAACAGGG - Intergenic
1173082337 20:39880140-39880162 AAGTTATACTTCATAGAATATGG - Intergenic
1177917581 21:27109478-27109500 CAGTAAGACTTTCTAAAAGAAGG - Intergenic
1182173570 22:28258652-28258674 GAGTAACACTTTACAGAAGAGGG + Intronic
1183195264 22:36349362-36349384 CAGTAAAACTCTATATAACCAGG + Intronic
1184823049 22:46925928-46925950 CCGTAATACTTTTGAGAAGATGG + Intronic
952594696 3:35001754-35001776 CAAGAATACTTTGAAGAACAAGG - Intergenic
952857118 3:37781397-37781419 CAGTAAAACTTTATAAAAACAGG + Intronic
958463593 3:94429578-94429600 CATTAATACTTGAAAGAAAAGGG - Intergenic
958720496 3:97837465-97837487 CAGCAATACTGTTGAGAACAGGG - Intronic
958887951 3:99749797-99749819 CATAAATATTTTCTAGAACAAGG + Intronic
959687070 3:109159073-109159095 CAGCAATAATTTTTATAACAAGG + Intergenic
964117694 3:153153803-153153825 CAGTAATACTTTATGAAAATAGG - Intergenic
964931865 3:162034653-162034675 CAGTAATACTCTTGAGAACTGGG - Intergenic
965914231 3:173821866-173821888 CACAAATACTTTCTAGCACAAGG - Intronic
966524887 3:180910132-180910154 TAGTAATACATTCTACAACATGG + Intronic
971843030 4:31879051-31879073 CAGTAATACTTGCTGGAAGAAGG - Intergenic
973157959 4:46981194-46981216 TATTAATATTTTATAGCACATGG - Intronic
976841188 4:89433933-89433955 CAGAGATACCTGATAGAACAAGG + Intergenic
977151386 4:93516925-93516947 CAATAATACTGTATAGAATGAGG - Intronic
977649808 4:99456428-99456450 CAGAAATACTTTAAATAAAATGG + Intergenic
979296147 4:119034611-119034633 CAGTCCCACTTTATAGAAGAGGG + Intronic
980177500 4:129364739-129364761 CATTAATAATTTAGAGAACTGGG - Intergenic
980541572 4:134202075-134202097 CTGCAGAACTTTATAGAACAAGG - Intergenic
980819897 4:138000905-138000927 TAATAATAATTTATAGAAAAAGG + Intergenic
981850807 4:149228325-149228347 CAGTTATGGTTTATGGAACAGGG - Intergenic
982046937 4:151457514-151457536 CAGTAATAAGTTCTGGAACATGG - Intronic
982638746 4:157929731-157929753 CACTCATACCTTATAGAACAGGG + Intergenic
983946711 4:173594161-173594183 CAATAAAACTTTATAGAAACAGG - Intergenic
984406294 4:179335691-179335713 AAGTAATAATTTATAGAAAGAGG - Intergenic
987077805 5:14400570-14400592 CATTAATACTGAAGAGAACATGG + Intronic
988242945 5:28637299-28637321 AAATGACACTTTATAGAACAGGG + Intergenic
988948040 5:36226598-36226620 CACTAATAATATATATAACAGGG + Intronic
994632047 5:102297979-102298001 CAGTAATAATACATAGTACATGG + Intergenic
994963785 5:106639719-106639741 GAGAAATACTTTATAGTATAGGG + Intergenic
995682814 5:114739504-114739526 CTGTTATACTTTTTAGAACCAGG + Intergenic
998483709 5:142483978-142484000 CAGAGATACTTTTTAAAACATGG + Intergenic
999154469 5:149448507-149448529 CAGTAATGGCTTATATAACATGG - Intergenic
1000199622 5:158995303-158995325 CAGTCATATTTTATTTAACAAGG + Intronic
1005232080 6:23713725-23713747 CATGAATACTATGTAGAACATGG - Intergenic
1005776746 6:29141319-29141341 TAGAAATAATTTATAGAATAAGG - Intergenic
1005801436 6:29429064-29429086 CAGTGTTACTTTCTAGAATATGG + Intronic
1006009526 6:31030845-31030867 CAGTAAAACTTTACAAAACCAGG - Intronic
1007040593 6:38718088-38718110 CATTAAAATTTTATTGAACAAGG + Intronic
1008200224 6:48578079-48578101 GTGTAATGCTTTAGAGAACAAGG + Intergenic
1008488872 6:52064687-52064709 CAGTTATGCTTTCTAGACCATGG + Intronic
1008593918 6:53022052-53022074 CAGTAAAAGCTTATAGAATAGGG + Intronic
1009866093 6:69399657-69399679 CAGGAATACTTTATACAGCTAGG - Intergenic
1010168633 6:72947362-72947384 AAGCTATACTTTATAGAAGAGGG + Intronic
1010814907 6:80346667-80346689 AAGTAATAATATAAAGAACATGG - Intergenic
1011404113 6:86999401-86999423 CATGAATAATTTATAAAACAAGG + Intronic
1012336904 6:98071004-98071026 CATTAAAAATTTATAAAACAAGG - Intergenic
1012570286 6:100717295-100717317 CAGTAATACATTAAAGACTAAGG + Intronic
1014060270 6:117063749-117063771 CAGAGATAGTTGATAGAACACGG - Intergenic
1014377748 6:120697591-120697613 CAGTAATAATTTTTATAATATGG - Intergenic
1014587216 6:123213754-123213776 AAGCAATGCTTTATAGAAAAGGG - Intergenic
1014838580 6:126189513-126189535 CAATAAAATTTTATAGAAAATGG + Intergenic
1015316257 6:131820311-131820333 CAGTAATATTTTTCAGAACTAGG + Intronic
1015629652 6:135219208-135219230 CAGTTACACTTTAAAGAAAATGG + Intergenic
1015690899 6:135921597-135921619 CAGTAATTCTTTATAAAAACAGG + Intronic
1015859953 6:137665492-137665514 CAGTAATCCTTCAAAGAAGAAGG + Intergenic
1017134120 6:151133370-151133392 GAGTAATTCTTTATAGAAGAAGG - Intergenic
1017339027 6:153298706-153298728 CATTATAATTTTATAGAACACGG - Intergenic
1024051432 7:45626221-45626243 CAGTAAAACTTTACAAAACAAGG + Intronic
1027805121 7:82809828-82809850 CTGTCATACTGTATAGAAAAAGG + Intronic
1028829149 7:95307592-95307614 CAGTAATACTTTCTTGATGAAGG + Intronic
1030003372 7:105090054-105090076 CAGAACTACGTTTTAGAACAGGG - Exonic
1030903534 7:115153466-115153488 CAGTAATCCTTAATCAAACAGGG + Intergenic
1030926931 7:115468905-115468927 AAGTATTACTTCATAGAATAGGG - Intergenic
1031741149 7:125432925-125432947 CAGGAATAGTTTATAATACAGGG + Intergenic
1032161154 7:129511847-129511869 CAGTATTTCTGTATTGAACAAGG - Intronic
1034294048 7:149956253-149956275 CAGGAATCCTTTAAAGTACAAGG - Intergenic
1034812021 7:154140620-154140642 CAGGAATCCTTTAAAGTACAAGG + Intronic
1035451282 7:158978634-158978656 CAATAATTCTTTATAGCACTGGG + Intergenic
1036445530 8:8818856-8818878 TAGATATTCTTTATAGAACAAGG - Intronic
1037531582 8:19780460-19780482 CAGTAATAGTTTCTAGAAATTGG - Intergenic
1037601323 8:20397169-20397191 GAGTAATACTGCAGAGAACATGG + Intergenic
1038489239 8:27958010-27958032 CAGTAAAACTTTATAAAAACAGG + Intronic
1039327807 8:36504196-36504218 AAGTAATAGGTAATAGAACAAGG + Intergenic
1041203554 8:55475095-55475117 CAGTGATACTAAATAGTACACGG + Intronic
1042278972 8:67034996-67035018 TAGTGATCCTTTATAGAATAAGG + Intronic
1042744266 8:72089261-72089283 AAGTAATACTTTATAGGATTTGG + Intronic
1043162369 8:76861977-76861999 CAGTAATTCATTCTTGAACAAGG - Intronic
1043332803 8:79138543-79138565 CAGATATACATTATAGAAAAAGG + Intergenic
1045798564 8:106075465-106075487 CAGGAGTACTATATAGAACAAGG + Intergenic
1046076479 8:109318546-109318568 TAGTAATCCTTAGTAGAACATGG + Intronic
1046263742 8:111804390-111804412 AAGTAATTTTTTTTAGAACACGG + Intergenic
1047508811 8:125500475-125500497 CAGTAAAACTTTCTAGATCAGGG - Intergenic
1047776828 8:128078312-128078334 GAGAAATAATTTAGAGAACAAGG - Intergenic
1048277299 8:133076709-133076731 TAGTAAAACTTTATTGAGCAAGG + Intronic
1048691484 8:136969639-136969661 TGGTGATACATTATAGAACAAGG - Intergenic
1050485495 9:6130147-6130169 TAGTAATACTTGCTACAACATGG + Intergenic
1050647026 9:7731308-7731330 CAGTAATAATAAATACAACAAGG + Intergenic
1050961599 9:11740158-11740180 CAGTAATCCTTTGTTGAAGAAGG - Intergenic
1051120759 9:13749684-13749706 CAGTAATGCTTTAAATAGCATGG + Intergenic
1051684996 9:19649029-19649051 CAGTAATTCTTTGGAAAACATGG + Intronic
1051787360 9:20759899-20759921 CAGTAATACTTTATCTCAAATGG - Intronic
1052092212 9:24342579-24342601 CAGGAAGACTTTTTAGAAAAGGG - Intergenic
1053109476 9:35445289-35445311 CTTAAATCCTTTATAGAACATGG - Intergenic
1055682552 9:78732232-78732254 AAATAATACTATAGAGAACATGG - Intergenic
1056596531 9:88012369-88012391 CAATAATACATAATAAAACAGGG + Intergenic
1058298996 9:103346254-103346276 GAGAATTACTTTTTAGAACAAGG + Intergenic
1058477927 9:105359203-105359225 CTGTACTACTTTATGGAAAAAGG - Intronic
1058844634 9:108944719-108944741 CAGTAATAATGGAGAGAACAGGG + Intronic
1186555900 X:10558087-10558109 CACTATTACTCTATAGAAAATGG + Intronic
1187672374 X:21680914-21680936 CAGTAATACTATATAAAAATGGG + Intergenic
1187777129 X:22773070-22773092 CAGTAATATTTTAAATAAGAGGG + Intergenic
1187923010 X:24224338-24224360 CAGGAATATTTTATATATCATGG - Intergenic
1188105202 X:26140867-26140889 CAGTAATAATGTATGGAAGATGG + Intergenic
1188239794 X:27771856-27771878 CAGTGATAGGTTATGGAACAGGG + Intergenic
1188446670 X:30259997-30260019 CTGTAGTAGTTTATATAACAAGG - Intergenic
1193100866 X:77609918-77609940 AGCTAATATTTTATAGAACAGGG + Intronic
1194520453 X:94912414-94912436 TATTAATATTTTATAGAAAATGG + Intergenic
1196506140 X:116445417-116445439 TACTATTACTCTATAGAACAAGG - Intronic
1196720828 X:118852255-118852277 TAGTAAGACTTTATAGAGGAGGG + Intergenic
1197332112 X:125166318-125166340 TAGAAAAACTTTATAGAAAATGG - Intergenic
1197505161 X:127292980-127293002 CATTAAGAATTTCTAGAACATGG + Intergenic
1201374255 Y:13299284-13299306 CATTAATACTTTGTATCACAGGG + Intronic
1201635750 Y:16120745-16120767 CAATAACAATTTATAAAACAAGG - Intergenic
1202012735 Y:20364698-20364720 AAAAAATACTTCATAGAACAGGG + Intergenic