ID: 1068631484

View in Genome Browser
Species Human (GRCh38)
Location 10:59303114-59303136
Sequence CTTCTCTCTGTTCCTTGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068631478_1068631484 -2 Left 1068631478 10:59303093-59303115 CCACACTCCAGCCACCCTGGCCT 0: 1
1: 6
2: 34
3: 200
4: 970
Right 1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG No data
1068631472_1068631484 26 Left 1068631472 10:59303065-59303087 CCTCTCCTACCACTCTCACCCTT 0: 1
1: 0
2: 5
3: 66
4: 662
Right 1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG No data
1068631473_1068631484 21 Left 1068631473 10:59303070-59303092 CCTACCACTCTCACCCTTGTTCA No data
Right 1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG No data
1068631475_1068631484 8 Left 1068631475 10:59303083-59303105 CCCTTGTTCACCACACTCCAGCC 0: 1
1: 1
2: 14
3: 80
4: 543
Right 1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG No data
1068631479_1068631484 -9 Left 1068631479 10:59303100-59303122 CCAGCCACCCTGGCCTTCTCTCT 0: 2
1: 12
2: 39
3: 222
4: 1142
Right 1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG No data
1068631470_1068631484 28 Left 1068631470 10:59303063-59303085 CCCCTCTCCTACCACTCTCACCC 0: 1
1: 1
2: 3
3: 89
4: 849
Right 1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG No data
1068631471_1068631484 27 Left 1068631471 10:59303064-59303086 CCCTCTCCTACCACTCTCACCCT 0: 1
1: 2
2: 9
3: 94
4: 869
Right 1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG No data
1068631476_1068631484 7 Left 1068631476 10:59303084-59303106 CCTTGTTCACCACACTCCAGCCA 0: 1
1: 0
2: 6
3: 107
4: 739
Right 1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG No data
1068631474_1068631484 17 Left 1068631474 10:59303074-59303096 CCACTCTCACCCTTGTTCACCAC 0: 1
1: 0
2: 1
3: 39
4: 333
Right 1068631484 10:59303114-59303136 CTTCTCTCTGTTCCTTGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068631484 Original CRISPR CTTCTCTCTGTTCCTTGAAC AGG Intronic
No off target data available for this crispr