ID: 1068631841

View in Genome Browser
Species Human (GRCh38)
Location 10:59306330-59306352
Sequence TGTTCTGGAGGTTTATCTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 244}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068631841_1068631844 9 Left 1068631841 10:59306330-59306352 CCATTAGATAAACCTCCAGAACA 0: 1
1: 0
2: 0
3: 15
4: 244
Right 1068631844 10:59306362-59306384 ACTGTAGTCTAGAGCATCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068631841 Original CRISPR TGTTCTGGAGGTTTATCTAA TGG (reversed) Intronic
905359471 1:37409267-37409289 TCCTCTGGGGGTTTATCTGATGG - Intergenic
907900378 1:58735690-58735712 TGTTCTGCCGGTTCTTCTAATGG - Intergenic
908945803 1:69495104-69495126 TGTTCTGGAGGTTTCCGTGAGGG - Intergenic
909700488 1:78516255-78516277 TGTTCAGAGGGTTTACCTAAGGG + Intronic
909724064 1:78812436-78812458 TGTTCTGACGGTGTCTCTAAGGG - Intergenic
910152396 1:84166388-84166410 TGTTCTGGAGGTTTTACAACAGG + Intronic
911850765 1:102816937-102816959 AGTTCTGGAGGCTTAACTCAAGG - Intergenic
913351860 1:117870239-117870261 AGTCTTGGTGGTTTATCTAATGG + Exonic
915117651 1:153610701-153610723 TTTTCTGGAGCTTTTTCTGAAGG + Intronic
915316792 1:155033321-155033343 TATTCTGAAGGCTTATGTAAGGG - Intronic
915377256 1:155407437-155407459 TATTTTGGAGGTATATCTTAAGG - Intronic
916193888 1:162205337-162205359 TGGTCTGGATGTTTAGCTAATGG + Intronic
918137814 1:181690927-181690949 TGTTATGGAGTTTACTCTAATGG + Intronic
918724420 1:187900063-187900085 TGTTCAGGTAGGTTATCTAAAGG + Intergenic
919467808 1:197943746-197943768 TGATCTGAAGGTTTATCTCGAGG + Intergenic
921450178 1:215296385-215296407 TGCTCTGGAAGGTTATATAAAGG + Intergenic
921837804 1:219795668-219795690 TGTTCTTTAAGTTTATCTAATGG - Intronic
923318868 1:232808945-232808967 TTTTCTGCAGGTTTATTTTAGGG - Intergenic
924224278 1:241908056-241908078 TGTTCTTCAGGTTTCTCTGAAGG - Intergenic
1062974734 10:1675062-1675084 TGTTCTGGAGGTTTGGGTTAAGG + Intronic
1062974748 10:1675128-1675150 TGTTCTGGAGGTTTAGGTTCAGG + Intronic
1062974806 10:1675392-1675414 TGTTCTGGAGGTTTGGGTTAAGG + Intronic
1063162711 10:3431250-3431272 TCTTGTGGAGGTGTATCTAATGG + Intergenic
1063195666 10:3740386-3740408 TATTCTGAAGGGTTATATAATGG - Intergenic
1065324721 10:24540595-24540617 TGTTCTGGGGGTCTATTTACTGG - Intronic
1068631841 10:59306330-59306352 TGTTCTGGAGGTTTATCTAATGG - Intronic
1069595645 10:69668349-69668371 TCTTCTGGATGTTTCTCTGAGGG - Intergenic
1070851774 10:79570078-79570100 TGTTCTTGAAATTTATATAAAGG + Intergenic
1072023841 10:91433673-91433695 TCATCTGCAGGTTTATCTATAGG + Intronic
1072459864 10:95609170-95609192 CGTTCTGGAGTTTTATATACTGG + Intronic
1072967213 10:99983949-99983971 TGTTCGGGTGGTTTAGATAAGGG - Intronic
1074159576 10:110826463-110826485 TTTTCTAGAGTTTTATATAAAGG + Intronic
1074702121 10:116101721-116101743 TGTTCTGGAAGAATATTTAAAGG - Intronic
1075611254 10:123856501-123856523 TGTTCAGGTGGGTCATCTAATGG - Intronic
1078575561 11:12499124-12499146 AGTTCTGGAAATTTATCTAAAGG - Intronic
1080490418 11:32757211-32757233 TGTTCTAGATTTTTATATAAAGG - Intronic
1082694925 11:56351001-56351023 CCTTCTGGATGTTTATCAAAGGG + Intergenic
1085652117 11:78277765-78277787 TGATCTGGAGTTTTATATATTGG - Intronic
1087962769 11:104372921-104372943 GGTTCTGGAGGTGATTCTAAAGG + Intergenic
1091524057 12:1279401-1279423 TTTTCTGGAGGTTTTTCTAGAGG - Intronic
1092030002 12:5276095-5276117 TGTTCTGGAGGTCCCGCTAAGGG + Intergenic
1092923425 12:13252612-13252634 TCTTCTGGATGTTTCTGTAAGGG - Intergenic
1094261747 12:28508368-28508390 TGTTCTAGGGGTTTACCTGATGG + Intronic
1094477165 12:30850148-30850170 TTCTCCTGAGGTTTATCTAAGGG - Intergenic
1094774133 12:33703039-33703061 AGTTCTTGAGCTTTATATAAAGG - Intergenic
1098197096 12:68013617-68013639 TATTCTGGATGTTTCTGTAAAGG + Intergenic
1100415204 12:94365409-94365431 TTTTCTGGAGGTGTATCTTCAGG - Intronic
1100617935 12:96245785-96245807 TGTTCTTGAGGTTTATTAAATGG - Intronic
1104421210 12:128637106-128637128 ACTTCTGGAGGTATATCCAAAGG - Intronic
1105231026 13:18495956-18495978 TGTTCTGGAATTTTATGTGAGGG + Intergenic
1106924737 13:34601798-34601820 ACTTCTGGGGATTTATCTAAGGG + Intergenic
1108236242 13:48409266-48409288 TTTGCTTTAGGTTTATCTAAAGG + Intronic
1109662436 13:65481258-65481280 TGTTCTGGAATTTTATTCAAAGG + Intergenic
1110280016 13:73682076-73682098 TATTCTGGATGTTTCTGTAAAGG - Intergenic
1111779975 13:92710087-92710109 TATTCTGGAAGTTTATGTACAGG - Intronic
1112257660 13:97849749-97849771 GGTTCTTGAGGTTTTTTTAAAGG - Intergenic
1112933169 13:104766581-104766603 TGCTCTGGAGATATTTCTAATGG + Intergenic
1114015990 14:18429680-18429702 TGTTCTGGAGTCTTATGTGAGGG + Intergenic
1114016288 14:18432558-18432580 TGTTCTGGAGTCCTATCTGAGGG + Intergenic
1114016336 14:18433038-18433060 TGTTCTGGAATTCTATGTAAGGG + Intergenic
1114016559 14:18435196-18435218 TGTTCTGGAGTCTTATGTGAGGG + Intergenic
1114021329 14:18481830-18481852 TGTTCTGGAATGTTATCTGAGGG - Intergenic
1114025619 14:18523519-18523541 TGTTCTGGAATCTTATCTGAGGG - Intergenic
1114026214 14:18529206-18529228 TGTTCTGGAATCTTATTTAAGGG - Intergenic
1114591742 14:23871733-23871755 TGTTCTTGATATTTATCCAAAGG + Intergenic
1114668375 14:24395604-24395626 TGTTCAGGAGGTTGACCTCAAGG + Intergenic
1115231880 14:31169392-31169414 CTTTCTCGAGCTTTATCTAATGG + Exonic
1116913797 14:50500747-50500769 TGTTCTGGAGGTAGAGCTGAGGG + Intronic
1120198362 14:81512113-81512135 TGTTCTGGAAGTTTCTATGAAGG + Intronic
1120447795 14:84623098-84623120 TGTTCAGCAATTTTATCTAAAGG + Intergenic
1121883815 14:97524574-97524596 TGTTCTGGATGTTTCTGTGAGGG - Intergenic
1202886256 14_KI270722v1_random:110147-110169 TGTTCTGGATTTTTATGTGATGG + Intergenic
1202887238 14_KI270722v1_random:119223-119245 TGTTCTGGAATTCTATGTAAGGG + Intergenic
1202887338 14_KI270722v1_random:120087-120109 TGTTCTGGAATTTTATGTGAGGG + Intergenic
1202887995 14_KI270722v1_random:126764-126786 TGTTCTGGAGTCTTATGTGAGGG + Intergenic
1202888073 14_KI270722v1_random:127435-127457 TGTTCTGGAGATCTATGTGAGGG + Intergenic
1202888084 14_KI270722v1_random:127531-127553 TGTTCTGGAGTCCTATGTAACGG + Intergenic
1126417422 15:48432381-48432403 TGTTCAGGAGGTATTTTTAATGG + Intronic
1133672878 16:8041276-8041298 TGTTCTGGATGTTTCTGTGAGGG - Intergenic
1135847504 16:25931976-25931998 TGGGCTGGAGGTTTTTTTAAAGG + Intronic
1137047389 16:35681001-35681023 TGATGTGTGGGTTTATCTAACGG + Intergenic
1146142942 17:30385038-30385060 TGTTCTGGAGAATCATCAAAAGG - Exonic
1148433237 17:47660250-47660272 TGTCCTCGAGATTCATCTAAGGG + Intronic
1150831291 17:68521768-68521790 TGTTCTGGAGATTAATATATGGG + Intronic
1203155981 17_GL000205v2_random:3940-3962 TGTTCTGGAGTTTTATGTGAGGG + Intergenic
1203156279 17_GL000205v2_random:6714-6736 TGTTCTGGAATCCTATCTAAGGG + Intergenic
1203158246 17_GL000205v2_random:25114-25136 TGTTCTGGAGTCTTATGTGAGGG + Intergenic
1153975491 18:10265151-10265173 TGGTCTAGAGGTTTATACAAGGG + Intergenic
1154522410 18:15244135-15244157 TGTTCTGGAATTTTATGTGAGGG - Intergenic
1155719644 18:28995118-28995140 TGTTCTGGTGATTTATGTAGTGG + Intergenic
1156187620 18:34681561-34681583 TATTCTAGAACTTTATCTAATGG + Intronic
1156738788 18:40298621-40298643 TGTTCAGGATGTTTATCCAAAGG - Intergenic
1158438179 18:57449256-57449278 TCTTCTGGATCTTAATCTAATGG - Intronic
1159799895 18:72885426-72885448 TGTGCTGGAAGTCTAACTAAAGG + Intergenic
1162520453 19:11176398-11176420 AGTTCTGGAGGCTTTGCTAAAGG - Intronic
1163087189 19:14990276-14990298 TGTTCTCCAGGTTCATCAAAAGG - Intronic
1202661720 1_KI270708v1_random:77641-77663 TGTTCTGGATTTTTATGTGATGG + Intergenic
1202662761 1_KI270708v1_random:87075-87097 TGTTCTGGAATTTTATGTGAGGG + Intergenic
1202663393 1_KI270708v1_random:93559-93581 TGTTCTGGAGTCTTATGTGAGGG + Intergenic
1202663464 1_KI270708v1_random:94182-94204 TGTTCTGGAGATCTATGTGAGGG + Intergenic
1202663474 1_KI270708v1_random:94278-94300 TGTTCTGGAGTCCTATGTAACGG + Intergenic
1202663523 1_KI270708v1_random:94662-94684 TGTTCTGGAATCTTATGTAAGGG + Intergenic
926943017 2:18157928-18157950 TGTTCAGGAGTTTTATTTCAGGG - Intronic
927695135 2:25234733-25234755 TGTCCTGGAGGTATTTCTGAGGG - Intronic
927907469 2:26870481-26870503 TGTTCATGAGGTTTGTCCAAGGG + Intronic
931020766 2:58042290-58042312 TGGTCTGATTGTTTATCTAATGG + Intronic
931030021 2:58163641-58163663 TGTTTTGTAGTTTTATGTAATGG + Intronic
937863954 2:126733879-126733901 TATTCTGGATGTTTCTGTAAAGG + Intergenic
938521663 2:132076704-132076726 TGTTCTGGAATTTTATGTGAGGG - Intergenic
941947210 2:171112663-171112685 GGTTCTGTAGATTTATTTAAGGG - Intronic
942965010 2:181881707-181881729 TATTCAGAAAGTTTATCTAAAGG - Intergenic
945325340 2:208475636-208475658 TTCTCTGGAGGGTTATTTAAAGG - Intronic
945571777 2:211477016-211477038 CATTCTGGATGTTTTTCTAAAGG + Intronic
946780140 2:223186252-223186274 TGTTTTGCAGATTTATCTAGTGG - Intronic
947449041 2:230188675-230188697 TGTTGAGGATCTTTATCTAAAGG + Intronic
1171055943 20:21906289-21906311 TTTTCTGGAGTTTTATATAGTGG + Intergenic
1174668588 20:52283963-52283985 TTTTCTGGAGGTTTATGTTTTGG + Intergenic
1176775015 21:13124309-13124331 TGTTCTGGAATTTTATGTGAGGG + Intergenic
1176775349 21:13127553-13127575 TGTTCTGGAATCCTATCTAAAGG + Intergenic
1179930179 21:44564883-44564905 TTTACTGGAGGTTTATTTTATGG - Intronic
1179974935 21:44859563-44859585 TGTTCTGGAGGTGTTTTTAATGG - Intronic
1180175707 21:46086923-46086945 TGTACTGGAGGTTTAACTAGCGG + Intergenic
1180329477 22:11463759-11463781 TGTTCTGGAATTCTATGTAAGGG + Intergenic
1180329566 22:11464575-11464597 TGTTCTGGAATTTTATGTGAGGG + Intergenic
1180330134 22:11470488-11470510 TGTTCTGGAGTCTTATGTGAGGG + Intergenic
1180330206 22:11471111-11471133 TGTTCTGGAGATCTATGTGAGGG + Intergenic
1180330213 22:11471207-11471229 TGTTCTGGAGTCCTATGTAACGG + Intergenic
1180440498 22:15360553-15360575 TGTTCTGGAGTCTTATGTGAGGG + Intergenic
1180440796 22:15363431-15363453 TGTTCTGGAGTCCTATCTGAGGG + Intergenic
1180440843 22:15363911-15363933 TGTTCTGGAATTCTATGTAAGGG + Intergenic
1180441066 22:15366069-15366091 TGTTCTGGAGTCTTATGTGAGGG + Intergenic
1180441095 22:15366357-15366379 TGTTCTGGAATCTTATCTGACGG + Intergenic
1180445784 22:15412176-15412198 TGTTCTGGAATGTTATCTGAGGG - Intergenic
1180448334 22:15436900-15436922 TGTTCTGGAATTCTATGTAAGGG - Intergenic
1180449803 22:15451144-15451166 TGTTCTGGAATCTTATCTGAGGG - Intergenic
1180450335 22:15456259-15456281 TGTTCTGGAGTCTTATTTAAGGG - Intergenic
1182064736 22:27422315-27422337 TGTTTTGGGGTTTTATGTAAAGG + Intergenic
949135447 3:559623-559645 TATTCTGGAGATCTTTCTAAAGG - Intergenic
951394726 3:22151730-22151752 TATTCTGGATGTTTCTGTAAAGG - Intronic
952840309 3:37640510-37640532 TGGTCTGGACGATTATCTAGAGG - Intronic
953838728 3:46370755-46370777 TGGTCTGAAGGTTTATTTACGGG - Intergenic
956479999 3:69663813-69663835 TGTTCTGAAGGTTTGTACAAAGG + Intergenic
957092849 3:75749307-75749329 TGTTCTGGAATTCTATGTAAGGG - Intronic
957093203 3:75752269-75752291 TGTTCTGGAATCTTATCTGAGGG - Intronic
957568793 3:81919194-81919216 TGTTCAGGAGGATGATCTTAAGG - Intergenic
959407854 3:105982636-105982658 TGTCCTTGAGGTTCATCAAATGG + Intergenic
961854159 3:129852519-129852541 TGTCCTCAAGGTTCATCTAAAGG - Intronic
967642299 3:191879947-191879969 TGTTATGCAGCTTTAGCTAACGG - Intergenic
969228033 4:5811831-5811853 TGGTCTGGAAGTTTCTCTACCGG - Exonic
971289514 4:25323963-25323985 TTTTCTAGAAGTTTATATAAAGG + Intronic
971511168 4:27426084-27426106 TTGTCTGGAGGTTTCTCTGATGG - Intergenic
976463855 4:85345204-85345226 TTTTCTGGTGGTTTGTATAATGG + Intergenic
978058943 4:104311976-104311998 TGTTCTGGGGCTCTAACTAAAGG + Intergenic
978085558 4:104648451-104648473 TGTTCTAGAGTTTTCTCTGATGG - Intergenic
978549408 4:109909116-109909138 TGTTCTTGAACTTTATATAAAGG - Intergenic
981421306 4:144553679-144553701 TGTTTTTGAGGATTATTTAATGG + Intergenic
981798595 4:148629338-148629360 AGAACTGGAGCTTTATCTAAAGG - Intergenic
981957013 4:150489792-150489814 TGTAAAGGAGGCTTATCTAAAGG - Intronic
983177918 4:164613233-164613255 TATTCTGGATGTTTCTATAAGGG - Intergenic
984485032 4:180357377-180357399 TGCTATGGATGTTTATATAAGGG - Intergenic
985158938 4:187024128-187024150 TGCTCTGGAGGTTGACCTATAGG + Intergenic
991144974 5:63290594-63290616 TGTTCTGAAGGTATGTCTACAGG + Intergenic
991405545 5:66297802-66297824 TATTCTGGATGTTTTTGTAAGGG - Intergenic
992005935 5:72477375-72477397 TGTCCTGGAAGTTGAGCTAATGG + Intronic
992210390 5:74474022-74474044 TATTCTGGATGTTTCTGTAAAGG - Intergenic
992632995 5:78699877-78699899 TGTTCTTGAGTTGCATCTAATGG - Intronic
994927282 5:106133023-106133045 TGTTCTCAAGTTTTATCTGAAGG - Intergenic
999031089 5:148291966-148291988 TGTTCTGCACTTTTATCTAGAGG - Intergenic
1000639534 5:163685220-163685242 TCTTCTGGATGTTTCTGTAAAGG - Intergenic
1000800221 5:165716922-165716944 TGTTGTTTAGGCTTATCTAATGG + Intergenic
1003668273 6:8131713-8131735 TGTTCTGTACGTTTAGCAAATGG + Intergenic
1003990755 6:11484054-11484076 TATTCTGCAGGTCAATCTAAAGG - Intergenic
1004559324 6:16732595-16732617 TGATTTGGAGCTTTATCAAATGG - Intronic
1008534015 6:52492930-52492952 TATTCTGGGGGTTTCTCTGAAGG + Exonic
1009413405 6:63392325-63392347 TGCTGTGGAGGTTTGTCTCAAGG - Intergenic
1010995887 6:82531933-82531955 TATTCTGGATGTTTCTGTAAGGG + Intergenic
1012519402 6:100103001-100103023 GTTTATGGAGGTTTATGTAAGGG + Intergenic
1013821783 6:114162676-114162698 TGTTCTGAAGGTTTGTGCAAGGG - Intronic
1016102814 6:140123809-140123831 TGTACTGGAGGTTGATTTTAGGG + Intergenic
1020711287 7:11608743-11608765 GGTTGTGGATGTTCATCTAAGGG - Intronic
1024795590 7:53015738-53015760 TCTTCTGGATGTTTCTCTGAAGG - Intergenic
1024825717 7:53387386-53387408 TGTTCTGCAGGTTTATTAATGGG - Intergenic
1027468402 7:78543095-78543117 TCTTTTGGAGGTTGATGTAATGG + Intronic
1031343583 7:120636303-120636325 TGTTATGGAGGTTTACTTAAAGG + Intronic
1031430252 7:121659204-121659226 TGTTCTGCATGATTATATAATGG - Intergenic
1031503437 7:122550847-122550869 TGTTCAATAGATTTATCTAAGGG + Intronic
1033429151 7:141272861-141272883 TCTTCTGGGTGTGTATCTAAAGG + Intronic
1033716295 7:144006154-144006176 TGTTCTGGAAGTTTATAAAATGG - Intergenic
1036683368 8:10892288-10892310 TGTTCTGGAGGTTGAACTGTGGG + Intergenic
1037789845 8:21928157-21928179 TTTTCTGGAATTTTATATAATGG + Intronic
1041079562 8:54203198-54203220 TGTTCTGGATGTTTTTGTGAGGG + Intergenic
1041881712 8:62759240-62759262 TGTTCTGGAGATCTAAATAAAGG + Intronic
1043620379 8:82183813-82183835 TATTCTGGGGATTTATGTAATGG - Intergenic
1044800795 8:95952790-95952812 TATTCTGGATGTTTCTGTAAGGG + Intergenic
1045706145 8:104925614-104925636 TGTTCTGGGTGTTTTTCTGAGGG + Intronic
1046272283 8:111912344-111912366 TATTGTATAGGTTTATCTAAAGG + Intergenic
1051192146 9:14524787-14524809 TGTTCTGGAGTGTGATATAATGG - Intergenic
1051297574 9:15612898-15612920 TTTTCTGCAGGTTTATGTAATGG + Intronic
1051724653 9:20076581-20076603 TGTTCTGGAGGCTTACATCAAGG - Intergenic
1053218134 9:36289668-36289690 TGTTCTGGATGTTTCTGTGAGGG + Intronic
1053700376 9:40683973-40683995 TGTTCTGGAATTTTATGTGAGGG - Intergenic
1053717208 9:40908818-40908840 TGTTCTGGAAAATTATGTAAGGG - Intergenic
1053717337 9:40910012-40910034 TGTTCTGGAGTGTTATGTGAGGG - Intergenic
1053717523 9:40911787-40911809 TGTTCTGGAGTTCTATGTGAGGG - Intergenic
1053718884 9:40925086-40925108 TGTTCTGGAATTCTATGTAAGGG - Intergenic
1054074910 9:60519602-60519624 TGTTCTGGAATTCTATGTAAGGG + Intergenic
1054311668 9:63483371-63483393 TGTTCTGGAATTTTATGTGAGGG - Intergenic
1054410450 9:64807524-64807546 TGTTCTGGAATTTTATGTGAGGG - Intergenic
1054881021 9:70144923-70144945 TGTCCTGGAGGGTTTTGTAATGG - Intronic
1055941046 9:81650111-81650133 TGTTGTGGAGGTTATTATAAAGG - Intronic
1056739224 9:89238579-89238601 TTTTCTAGAGTTTTATGTAAAGG - Intergenic
1058631830 9:106996753-106996775 TGTTCTATAGGTTGATCTTATGG + Intronic
1058853497 9:109036686-109036708 TGTTCTGTAGGTGTATTTATAGG - Intronic
1062594610 9:137293542-137293564 TGTTCCAGAGCTTTCTCTAAAGG - Intergenic
1203440221 Un_GL000219v1:517-539 TGTTCTGGAGTCCTATATAAGGG + Intergenic
1203457104 Un_GL000219v1:178567-178589 TGTTCTGGAAAATTATGTAAGGG + Intergenic
1203485195 Un_GL000224v1:46982-47004 TGTTCTGGAGTCTTATGTGAGGG + Intergenic
1203485235 Un_GL000224v1:47318-47340 TGTTCTGGAGTCCTATGTAATGG + Intergenic
1203493067 Un_GL000224v1:125061-125083 TGTTCTGGAATTCTATGTAAGGG - Intergenic
1203493578 Un_GL000224v1:129727-129749 TGTTCTGGAATTCTATGTAAGGG - Intergenic
1203494239 Un_GL000224v1:135861-135883 TGTTCTGGAAGTGTATGCAAGGG - Intergenic
1203494381 Un_GL000224v1:137061-137083 TGTTCTGGAGTCCTATCTGAGGG - Intergenic
1203494421 Un_GL000224v1:137445-137467 TGTTCTGGAGTTCTATGTGAGGG - Intergenic
1203494426 Un_GL000224v1:137493-137515 TGTTCTGGAATCTTATGTAACGG - Intergenic
1203495949 Un_GL000224v1:151673-151695 TGTTCTGGAGTCCTATGTAAGGG + Intergenic
1203496003 Un_GL000224v1:152106-152128 TGTTCTGGAGTCTTATGTGATGG + Intergenic
1203497320 Un_GL000224v1:164312-164334 TGTTCTGGAATCTTATCTGAGGG + Intergenic
1203497462 Un_GL000224v1:165703-165725 TGTTCTGGAATACTATCTAAGGG + Intergenic
1203498254 Un_GL000224v1:173605-173627 TGTTCTGGTGTTGTATCTGAGGG + Intergenic
1203498572 Un_GL000224v1:176660-176682 TGTTCTGGAGTCCTATATAAGGG + Intergenic
1203506199 Un_KI270741v1:71602-71624 TGTTCTGGAATTCTATGTAAGGG - Intergenic
1203506858 Un_KI270741v1:77736-77758 TGTTCTGGAAGTGTATGCAAGGG - Intergenic
1203507000 Un_KI270741v1:78936-78958 TGTTCTGGAGTCCTATCTGAGGG - Intergenic
1203507040 Un_KI270741v1:79320-79342 TGTTCTGGAGTTCTATGTGAGGG - Intergenic
1203507045 Un_KI270741v1:79368-79390 TGTTCTGGAATCTTATGTAACGG - Intergenic
1203508573 Un_KI270741v1:93596-93618 TGTTCTGGAGTCCTATGTAAGGG + Intergenic
1203508626 Un_KI270741v1:94029-94051 TGTTCTGGAGTCTTATGTGATGG + Intergenic
1203509879 Un_KI270741v1:106368-106390 TGTTCTGGAATCTTATCTGAGGG + Intergenic
1203510021 Un_KI270741v1:107759-107781 TGTTCTGGAATACTATCTAAGGG + Intergenic
1203510808 Un_KI270741v1:115855-115877 TGTTCTGGTGTTGTATCTGAGGG + Intergenic
1203511107 Un_KI270741v1:118948-118970 TGTTCTGGAGTCCTATATAAGGG + Intergenic
1185986486 X:4840712-4840734 TGTTCTAGAAGTTTAGTTAAAGG + Intergenic
1185999475 X:4992472-4992494 TGTTTTGGAAGTTTCTCTAGAGG - Intergenic
1187402191 X:18970870-18970892 TGTGCTTGAGTTTTAGCTAAAGG + Intronic
1187860155 X:23674166-23674188 AGTTCTGGAGGTTTCTGAAAGGG - Intronic
1188454251 X:30344537-30344559 TGTTCTGGAAGACTTTCTAAAGG + Intergenic
1188467853 X:30502983-30503005 CCTTCTGGAGGCTTATCTAAGGG - Intergenic
1188576902 X:31662689-31662711 TGTTCTGCAGTTTGATCTTAAGG + Intronic
1189685870 X:43563015-43563037 TATTCTGGATGTTTCTCTGAAGG + Intergenic
1190780092 X:53585632-53585654 AGTTCTAGAGGCTGATCTAAGGG - Intronic
1190952117 X:55156320-55156342 TGTTGTGGAGGTTCACATAAAGG - Intronic
1192116054 X:68412323-68412345 TGTTCTTAAGGTTCATCTGAAGG - Intronic
1193221580 X:78932979-78933001 TGTTCTGGAGGTTCAGAAAATGG + Intergenic
1193855002 X:86589754-86589776 TTTTCTGGAGTGTTATCTATTGG + Intronic
1194306003 X:92249034-92249056 TGTCCTGGAGTTTGATATAAAGG + Intronic
1194605179 X:95971118-95971140 TTTTCTGGATATATATCTAAAGG - Intergenic
1196088326 X:111710500-111710522 TTTTCTAGAGTTTTATATAAGGG - Intronic
1197452503 X:126637534-126637556 TATTCTGGATGTTTCTGTAAGGG + Intergenic
1197747642 X:129942984-129943006 TTTTCTGGAATTTTATATAATGG - Intergenic
1198202918 X:134439979-134440001 TGTTCTAGAAATTTATCTTAAGG - Intergenic