ID: 1068633501

View in Genome Browser
Species Human (GRCh38)
Location 10:59322772-59322794
Sequence ACTGGAATCAATTTAGTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068633501_1068633505 20 Left 1068633501 10:59322772-59322794 CCACTGACTAAATTGATTCCAGT 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1068633505 10:59322815-59322837 ACAATAATACCTCAAAGAGGAGG No data
1068633501_1068633504 17 Left 1068633501 10:59322772-59322794 CCACTGACTAAATTGATTCCAGT 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1068633504 10:59322812-59322834 CTTACAATAATACCTCAAAGAGG No data
1068633501_1068633506 21 Left 1068633501 10:59322772-59322794 CCACTGACTAAATTGATTCCAGT 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1068633506 10:59322816-59322838 CAATAATACCTCAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068633501 Original CRISPR ACTGGAATCAATTTAGTCAG TGG (reversed) Intronic
902999990 1:20258473-20258495 ACTGGAGTCAACCTAGTCAAAGG + Intergenic
910173669 1:84404738-84404760 ACTGGAACCAATTTAGAAAAAGG + Intronic
910779690 1:90916338-90916360 ATTTGAGTAAATTTAGTCAGCGG + Exonic
910973370 1:92879768-92879790 ACTAGAAACATTTTAGTGAGTGG - Intronic
913996325 1:143654117-143654139 CCTGGCATCTATCTAGTCAGCGG - Intergenic
915392270 1:155554776-155554798 ACTGGAAAAATGTTAGTCAGTGG + Intronic
917030734 1:170687801-170687823 TCTGGAAACAATTTAGTCTGAGG + Intronic
919023091 1:192134319-192134341 TGTGGAATCAATGTAGTCACAGG + Intergenic
919289116 1:195605717-195605739 AATGGAATCAATTGTGTCAGAGG - Intergenic
923059440 1:230457100-230457122 AATGGAATCAATTTAGATAATGG - Intergenic
923290331 1:232539188-232539210 ACTGGCATCAGGTTAGACAGAGG - Intronic
924957025 1:248939443-248939465 ATTGTAATCACATTAGTCAGGGG - Intergenic
1063939234 10:11109865-11109887 ATTGGCAGCAGTTTAGTCAGTGG + Intronic
1066037328 10:31506481-31506503 AAAGGAATCAATTCAGTAAGAGG - Intronic
1068633501 10:59322772-59322794 ACTGGAATCAATTTAGTCAGTGG - Intronic
1072423760 10:95311562-95311584 ACAGTAATCAATTAATTCAGAGG + Intergenic
1073724558 10:106214855-106214877 AGTGGAATCAATTGAGTGAGTGG - Intergenic
1079509248 11:21191228-21191250 GGTGGGATCAATTTAGTCACAGG + Intronic
1081310694 11:41568078-41568100 ACTGGAAATAATTTAGCCAGAGG - Intergenic
1082732293 11:56814752-56814774 TCTGGAATCAAATTACTCACTGG + Intergenic
1085481198 11:76824240-76824262 AATGGAATCAACTCAGTCTGCGG + Intergenic
1086688312 11:89758814-89758836 AATGGAATTAATTTAATCAACGG - Intergenic
1088021714 11:105127749-105127771 ATGGGAATCAATTTAGACACAGG + Intergenic
1088148897 11:106720132-106720154 ACTGGAATGCATTAAGTCTGAGG - Intronic
1091145766 11:133278760-133278782 TCTGGAATCAATTGAGTAGGTGG - Intronic
1097404161 12:59168400-59168422 GGTGGAATTAATTTAGTCAAAGG - Intergenic
1097746346 12:63307925-63307947 ATTGGAATCAATTTTGTCTCTGG - Intergenic
1099070386 12:78038952-78038974 ACTTGAAGCATTTTGGTCAGAGG + Intronic
1107965566 13:45595090-45595112 AAAGGAATCATTTTAGTCTGTGG - Intronic
1108539222 13:51421821-51421843 ACTGGTGTCAAGTAAGTCAGAGG - Intronic
1109340436 13:61051490-61051512 ACTGGATTTAATTTAGGCAATGG + Intergenic
1110356109 13:74569571-74569593 ACTGGAATCAATTACAACAGAGG + Intergenic
1110484449 13:76021678-76021700 AATGCACTCACTTTAGTCAGTGG - Intergenic
1112956730 13:105068868-105068890 AGTGAAATCATTTTAGGCAGAGG + Intergenic
1116127418 14:40806214-40806236 ACTACTCTCAATTTAGTCAGTGG - Intergenic
1118080744 14:62357350-62357372 ACTGGAAATAATTCAGTTAGAGG - Intergenic
1119077848 14:71661868-71661890 ACGTGAATCAAGTAAGTCAGAGG - Intronic
1119170072 14:72528275-72528297 ACTAGAATCAATAGAGTCCGAGG - Intronic
1121951913 14:98178384-98178406 CCCGGAATCAAATTAGTCAAAGG + Intergenic
1124124015 15:26920315-26920337 ACTGGAAATTATTCAGTCAGAGG - Intronic
1124675654 15:31683037-31683059 AGTGGAATCAAGATAGTCAACGG + Intronic
1133908679 16:10044908-10044930 ACTGTGATCTATTTAGTCAAGGG + Intronic
1134908610 16:18004065-18004087 ACAGGAGTTAATTTTGTCAGTGG + Intergenic
1145097027 17:20038863-20038885 ACTGGAATCAAACTAGAAAGAGG - Intronic
1145859328 17:28194475-28194497 AGTGGAATTAATTTTTTCAGAGG + Intronic
1147796819 17:43049722-43049744 GCTGGAATCCATATACTCAGGGG + Intronic
1152952074 17:83243515-83243537 ATTGTAATCACATTAGTCAGGGG - Intergenic
1155766302 18:29637659-29637681 ACTGGAAATTATTCAGTCAGAGG - Intergenic
1156166918 18:34432613-34432635 ACTGAAATAAATTATGTCAGGGG - Intergenic
1156343070 18:36229712-36229734 ACTGGAAATAATTCAGTCAGAGG - Intronic
1157077754 18:44484705-44484727 ACAGGGATCAATTTAGCAAGAGG + Intergenic
1158286938 18:55894051-55894073 ACTGGAATTAATGTTGCCAGGGG + Intergenic
1158932751 18:62337000-62337022 TCTGGAATCAAGGTGGTCAGAGG + Intronic
1159292124 18:66436399-66436421 GCTAGAATCTATTTAGGCAGTGG + Intergenic
1165635689 19:37337785-37337807 ATTGCATTCAATTAAGTCAGGGG - Intronic
927199497 2:20569686-20569708 ACTGGGATCAATGGAGTCGGAGG - Intronic
930426893 2:51224071-51224093 ACTGAATTCAACTCAGTCAGAGG + Intergenic
931826793 2:66008607-66008629 ACTGGAATGAAATTTGTCTGGGG - Intergenic
933390090 2:81656963-81656985 ACTGGAGTCCTTTTAGACAGGGG + Intergenic
936570491 2:113609272-113609294 ATTGTAATCACATTAGTCAGGGG + Intergenic
937862915 2:126725351-126725373 ACTAGAAATAATTCAGTCAGAGG + Intergenic
939428546 2:142072699-142072721 AGTGTAATCATTTAAGTCAGGGG - Intronic
941557847 2:167005657-167005679 ACTGTTATCAATTTACCCAGAGG + Intronic
941720843 2:168811049-168811071 ACTGGAATTAAATGAGACAGAGG + Intronic
943561616 2:189470200-189470222 ACTGGGATCTATTTAGCCACTGG - Exonic
946592941 2:221271607-221271629 ACTGCAATCAGTTTAGTAATTGG + Intergenic
947013528 2:225591884-225591906 ATTGGCATCAATTTAGGAAGGGG + Intronic
947972836 2:234338369-234338391 ACTGGCAGAAATGTAGTCAGAGG + Intergenic
1172986712 20:38997494-38997516 TCTGGAAGCAATTTTGTAAGCGG + Intronic
1173359968 20:42334267-42334289 ACTGGCATCTAGTTAGTGAGTGG - Intronic
1174611577 20:51801946-51801968 AGTGGAACCAATTAAGTGAGGGG + Intronic
1180263487 21:46693339-46693361 ATTGTAATCACATTAGTCAGGGG - Intergenic
1181163439 22:20971045-20971067 AATGGAAGCCATTAAGTCAGGGG - Intronic
1185429717 22:50801700-50801722 ATTGTAATCACATTAGTCAGGGG - Intergenic
949703046 3:6781179-6781201 ACTGGAGGCAATTTTTTCAGAGG + Intronic
951347687 3:21565972-21565994 ACTGGAATCAGTTAATTCACAGG + Intronic
952395975 3:32921158-32921180 ACTGGGAGCATTTTATTCAGAGG - Intergenic
953068973 3:39501294-39501316 ACAGGAATCAACTTAGTTAATGG - Intronic
954561370 3:51559484-51559506 AGTGGAATCAAGTGAGGCAGTGG - Intronic
958670223 3:97194782-97194804 AATGGAGTCAATTCAGTAAGAGG - Intronic
958894461 3:99814420-99814442 ACTGAAAATAATTTAGTAAGGGG + Intergenic
963645860 3:147913391-147913413 AGTGGAAACAATTGAGTCAAGGG + Intergenic
964266897 3:154907957-154907979 AGTGGAGTCAATTTAGTAAGAGG + Intergenic
966547404 3:181165992-181166014 TCTGGAAATAATTTAGTGAGAGG - Intergenic
966990528 3:185225711-185225733 ACTGGAATGAAATGAGTCAGGGG - Intronic
967570184 3:191019197-191019219 ACAGGAATTAATTTAGACATTGG + Intergenic
970470438 4:16372937-16372959 AATTGAATCAATTCAGTAAGTGG + Intergenic
970767908 4:19573266-19573288 ATTGGAATCCATTTAAGCAGAGG + Intergenic
973693342 4:53464235-53464257 ACTGGAATCTATTAAGTTAATGG - Intronic
974506827 4:62785964-62785986 ACTTGAATAAATATAGGCAGAGG - Intergenic
976138458 4:81964062-81964084 ACTAGGATCAAATTAGTCATGGG + Intronic
976386037 4:84459814-84459836 ACTCTTATTAATTTAGTCAGAGG - Intergenic
983887752 4:172999428-172999450 AGTGGATACAATTTTGTCAGTGG - Intronic
986990013 5:13541035-13541057 AATTTAATCAATTTAGTCATAGG - Intergenic
989514235 5:42323162-42323184 ACTGGAATCATTAGAGTGAGGGG - Intergenic
991398167 5:66226107-66226129 ACAGGAATGAATTTGGTCACAGG + Intergenic
994614383 5:102085459-102085481 ACTGGAAATATTTTAATCAGGGG - Intergenic
994720540 5:103374655-103374677 ACTGAGATTATTTTAGTCAGAGG + Intergenic
995827151 5:116313403-116313425 AAAGGAATCAATTTAGCAAGAGG - Intronic
997757854 5:136416876-136416898 TCAGAAATCCATTTAGTCAGTGG + Intergenic
998425167 5:142020379-142020401 ACTGAAATCAATTAAGTAAATGG - Intergenic
998716983 5:144895506-144895528 AAAGGAATCAATTCAGTAAGTGG + Intergenic
999860106 5:155635809-155635831 ACTGGAATGAATTGAATCTGAGG - Intergenic
1000222834 5:159230624-159230646 GCTGGAACCAAGTAAGTCAGAGG + Intergenic
1005533703 6:26734035-26734057 ACTAAAATCAAGCTAGTCAGAGG - Intergenic
1005534946 6:26745661-26745683 CCTGAAATCAAGCTAGTCAGAGG + Intergenic
1005537092 6:26767619-26767641 ACTAAAATCAAGCTAGTCAGAGG + Intergenic
1006043829 6:31276527-31276549 ACTGGAATTGATATATTCAGTGG - Intronic
1006342631 6:33454922-33454944 ACTGGAAACTTTTAAGTCAGTGG - Intronic
1007939697 6:45768564-45768586 ACTGTAAACAATTTAATGAGAGG - Intergenic
1008731583 6:54489694-54489716 AAAGGAATCAATTTAGCAAGAGG - Intergenic
1009007980 6:57810035-57810057 ACTAAAATCAAGCTAGTCAGAGG + Intergenic
1009808147 6:68628957-68628979 ACTGGAAGCAGTTTAGTCACTGG + Intergenic
1012227788 6:96724585-96724607 ATTTGAATCATTTGAGTCAGTGG - Intergenic
1012924303 6:105252159-105252181 ACTGAAATCAGTTGAGTTAGGGG + Intergenic
1014460544 6:121689738-121689760 ACTGGAATAAAATTATACAGGGG + Intergenic
1014473644 6:121846635-121846657 ACTGGAAATAATTTGGCCAGAGG + Intergenic
1014670276 6:124295340-124295362 AATGCAATAAATTTAGTCAAAGG + Intronic
1018575511 6:165255777-165255799 CCTGGAGTCAATGTAGCCAGTGG - Intergenic
1022610755 7:31869545-31869567 AAAGGAATCAATTCAGCCAGAGG + Intronic
1023356305 7:39370610-39370632 GCAGGAATTAATTTAGGCAGAGG - Intronic
1028625586 7:92873141-92873163 ACTGGAACCAACTAAGTCACTGG - Intergenic
1029005964 7:97210041-97210063 AATAGAATCAATTAAATCAGTGG - Intergenic
1031499399 7:122493917-122493939 TCTATAATCAATTTTGTCAGAGG + Intronic
1032379397 7:131460888-131460910 ACTGGAATTACTTTCGTAAGTGG - Intronic
1034741797 7:153481274-153481296 AATGGGATCAACTTAGTAAGAGG + Intergenic
1037436324 8:18867460-18867482 ACTGTGATCATTTTAGTCTGTGG - Intronic
1040578260 8:48673564-48673586 ACAGGAATTAACTTATTCAGGGG - Intergenic
1041959203 8:63593216-63593238 ACTTGAAACTATTCAGTCAGAGG - Intergenic
1042510963 8:69610478-69610500 TCTGGAATCAGGTTAGCCAGGGG - Intronic
1043200189 8:77359631-77359653 AATGGGATCAATTTTATCAGTGG - Intergenic
1045757800 8:105566262-105566284 ACTGGTATCAATTTTTTCAGGGG - Intronic
1045941464 8:107743936-107743958 AATGTAATTAATTTTGTCAGTGG - Intergenic
1046110160 8:109713285-109713307 GCTGGAATCAATGTAGACAATGG - Intergenic
1048517285 8:135122566-135122588 ACTGGAGTCAATGCAGTCACGGG + Intergenic
1050443651 9:5694472-5694494 ACTGAAATCAAATTAGACACGGG - Intronic
1053511087 9:38688197-38688219 CCTGGACTCAATTGGGTCAGGGG + Intergenic
1056592754 9:87976659-87976681 TCTGGAATCAATTTTGTGAATGG - Intergenic
1056851788 9:90091030-90091052 CCAGGAATCAAATTAATCAGGGG + Intergenic
1058577715 9:106421480-106421502 ACTGGCCTGAATTTAGTCACAGG + Intergenic
1059947074 9:119420350-119420372 ACTGCAATCAATTTCTTCAATGG + Intergenic
1186029346 X:5350019-5350041 AAAGGAAGCAATTTGGTCAGGGG + Intergenic
1186224103 X:7378879-7378901 GCTGGAATCAAGGTGGTCAGTGG + Intergenic
1186549250 X:10485230-10485252 ACTGTAATCATTTAAGCCAGGGG - Intronic
1192439251 X:71162838-71162860 CCTGGAATCAACTTTGTGAGAGG - Intronic
1193176105 X:78395686-78395708 AAAGGAATCAATTCAGTAAGAGG + Intergenic
1193604699 X:83551703-83551725 ATTGCAATAAATTGAGTCAGAGG + Intergenic
1194989865 X:100535896-100535918 ACTGGAAACTACTGAGTCAGAGG - Intergenic
1195199745 X:102536386-102536408 GATGGAATCAATTTAGCAAGAGG + Intergenic
1199339861 X:146664275-146664297 ATTGGACTCAATTTAATCACAGG + Intergenic
1199538442 X:148930410-148930432 ACTGGAATGGAATTACTCAGGGG + Intronic
1199637446 X:149826804-149826826 ACTGGAGTCCTTTTAGACAGGGG - Intergenic
1201385343 Y:13434703-13434725 AACAGAATCAATTTAGCCAGAGG + Intronic