ID: 1068633502

View in Genome Browser
Species Human (GRCh38)
Location 10:59322790-59322812
Sequence GAAAGCTATTTTTTGGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068633502_1068633504 -1 Left 1068633502 10:59322790-59322812 CCAGTAGCCAAAAAATAGCTTTC No data
Right 1068633504 10:59322812-59322834 CTTACAATAATACCTCAAAGAGG No data
1068633502_1068633505 2 Left 1068633502 10:59322790-59322812 CCAGTAGCCAAAAAATAGCTTTC No data
Right 1068633505 10:59322815-59322837 ACAATAATACCTCAAAGAGGAGG No data
1068633502_1068633508 22 Left 1068633502 10:59322790-59322812 CCAGTAGCCAAAAAATAGCTTTC No data
Right 1068633508 10:59322835-59322857 AGGGAGAATGTCCTGATTACTGG No data
1068633502_1068633506 3 Left 1068633502 10:59322790-59322812 CCAGTAGCCAAAAAATAGCTTTC No data
Right 1068633506 10:59322816-59322838 CAATAATACCTCAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068633502 Original CRISPR GAAAGCTATTTTTTGGCTAC TGG (reversed) Intronic
No off target data available for this crispr