ID: 1068633503

View in Genome Browser
Species Human (GRCh38)
Location 10:59322797-59322819
Sequence ATTGTAAGAAAGCTATTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 393}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068633503_1068633508 15 Left 1068633503 10:59322797-59322819 CCAAAAAATAGCTTTCTTACAAT 0: 1
1: 0
2: 2
3: 27
4: 393
Right 1068633508 10:59322835-59322857 AGGGAGAATGTCCTGATTACTGG No data
1068633503_1068633505 -5 Left 1068633503 10:59322797-59322819 CCAAAAAATAGCTTTCTTACAAT 0: 1
1: 0
2: 2
3: 27
4: 393
Right 1068633505 10:59322815-59322837 ACAATAATACCTCAAAGAGGAGG No data
1068633503_1068633510 28 Left 1068633503 10:59322797-59322819 CCAAAAAATAGCTTTCTTACAAT 0: 1
1: 0
2: 2
3: 27
4: 393
Right 1068633510 10:59322848-59322870 TGATTACTGGAGAAATTACAAGG No data
1068633503_1068633504 -8 Left 1068633503 10:59322797-59322819 CCAAAAAATAGCTTTCTTACAAT 0: 1
1: 0
2: 2
3: 27
4: 393
Right 1068633504 10:59322812-59322834 CTTACAATAATACCTCAAAGAGG No data
1068633503_1068633506 -4 Left 1068633503 10:59322797-59322819 CCAAAAAATAGCTTTCTTACAAT 0: 1
1: 0
2: 2
3: 27
4: 393
Right 1068633506 10:59322816-59322838 CAATAATACCTCAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068633503 Original CRISPR ATTGTAAGAAAGCTATTTTT TGG (reversed) Intronic
901138685 1:7014016-7014038 ATTTTAAGAACTGTATTTTTAGG - Intronic
903271506 1:22191380-22191402 ATTCTAGGAAGGATATTTTTTGG - Intergenic
903407253 1:23108276-23108298 CTTTTAAGAAAGTTACTTTTTGG - Intronic
906204926 1:43981576-43981598 GTTGTAAGAGGGCTATTCTTGGG + Intronic
906406086 1:45543303-45543325 ATTGTAAGGAACTTAGTTTTAGG - Intergenic
906829716 1:49018350-49018372 ATTCCAAGAAAGGTATTCTTGGG - Intronic
906853335 1:49277640-49277662 ATTGAAAGAAGCATATTTTTTGG - Intronic
908079230 1:60557612-60557634 GTTTTAACAAAGGTATTTTTGGG + Intergenic
908107133 1:60856537-60856559 ATTGAATGAGAGCTATTTTCAGG - Intergenic
908470444 1:64438791-64438813 ATTGTATGAAAGGTATTTCATGG + Intergenic
909026649 1:70488730-70488752 AATTTAAAAAAGCTGTTTTTAGG + Intergenic
909172225 1:72311707-72311729 ATTCTAAGAAAGTGATTTCTGGG + Intergenic
909310650 1:74143294-74143316 ATTTTAATAAAGATAGTTTTTGG + Intronic
909792270 1:79694303-79694325 TTTGTAAGATAGCTACTTTCAGG - Intergenic
910577438 1:88781007-88781029 ATTGTAAGATACTTCTTTTTAGG - Intronic
910606488 1:89091176-89091198 AACTAAAGAAAGCTATTTTTTGG + Intergenic
911811079 1:102282951-102282973 ATTGTAAGAACAGTTTTTTTGGG - Intergenic
912306010 1:108568210-108568232 ATTGAAAGAAAGCAAATATTGGG + Intronic
913718724 1:121568002-121568024 ATTGTAAGTAAAACATTTTTAGG + Intergenic
914391526 1:147227795-147227817 ATTGTTTGAAAGCTCTTTCTGGG - Intronic
914859951 1:151377650-151377672 ATTGCATGAAAGCCATTTTATGG - Intergenic
914936838 1:151989097-151989119 ATTTTAAAAAGGCTAATTTTAGG + Intronic
915697365 1:157757658-157757680 ATTGTAAGAAAATTAATTTTGGG + Intronic
916753286 1:167743079-167743101 ATTGTATGCAGGCTCTTTTTTGG + Intronic
917133720 1:171767963-171767985 ATATTTAGAAAGCTATTGTTTGG - Intergenic
917540781 1:175912025-175912047 AATGTCAGAAAGGTATATTTTGG + Intergenic
917710807 1:177682089-177682111 CTTTTGAGAAAGCTTTTTTTGGG - Intergenic
918515175 1:185355776-185355798 ATTGCAACAAAGATTTTTTTAGG - Intergenic
918519493 1:185400100-185400122 ATGGAAAAAAAGATATTTTTAGG - Intergenic
918962994 1:191304875-191304897 TTTGTAAGAAAGTTTTATTTGGG + Intergenic
919552720 1:199011948-199011970 ACTGTAAGAAAGATGTTTTAAGG - Intergenic
919955121 1:202406452-202406474 ACTAAAATAAAGCTATTTTTAGG + Intronic
921485597 1:215712208-215712230 ATATTTAGAAAGCTACTTTTAGG + Intronic
921632031 1:217446016-217446038 ATTGTCAGAAAACTATAATTAGG - Intronic
922580447 1:226693485-226693507 ATTGTAAGCAATCTAATTTATGG + Intronic
923647743 1:235841349-235841371 ATTGGAAGAACCGTATTTTTAGG + Intronic
924033507 1:239911277-239911299 ATTGTAAGAATGATTTTTTTGGG + Exonic
924217503 1:241839295-241839317 AGTGTAAGAAAGGTGTTTTTGGG + Intergenic
1062780271 10:198428-198450 ATTGAAAGGAAGGGATTTTTTGG + Intronic
1062792053 10:313726-313748 TCAGTAAGAAAGTTATTTTTTGG - Intronic
1063228204 10:4036014-4036036 ATGCTAAGAATGCCATTTTTAGG + Intergenic
1063330731 10:5156443-5156465 ATAGTAAAACAGATATTTTTTGG + Intergenic
1063891672 10:10636243-10636265 TTTGTAACAAAGCTAATATTTGG + Intergenic
1065451714 10:25865539-25865561 ATTGAAAGAAAGCTACTATGAGG + Intergenic
1065746937 10:28850737-28850759 TTTGTATAAAAGCTATTTTGAGG - Intronic
1066270594 10:33819087-33819109 ATTTTAAGAAATCTTTTTTATGG + Intergenic
1066396934 10:35034972-35034994 ATTATTAGAAAGCTATTGATAGG - Intronic
1068347453 10:55800209-55800231 ATTCAATGAAAGCTATATTTGGG + Intergenic
1068633503 10:59322797-59322819 ATTGTAAGAAAGCTATTTTTTGG - Intronic
1069177956 10:65317645-65317667 ATTCTAAGAAAACTAAATTTTGG - Intergenic
1070031994 10:72685935-72685957 ATTTTCAAAATGCTATTTTTGGG - Intergenic
1070322055 10:75361952-75361974 ATAATCAGAAAGCTGTTTTTGGG + Intergenic
1070867859 10:79718750-79718772 ATTCTTAGAAAGCCATTATTAGG + Intergenic
1071660471 10:87497044-87497066 ATTCTTAGAAAGCCATTATTAGG - Intergenic
1072000623 10:91192437-91192459 ATATTAAGAAAGCAATTCTTTGG + Intronic
1072054745 10:91743863-91743885 GTTTTAATAAAGCTGTTTTTTGG + Intergenic
1072119027 10:92389863-92389885 CATAAAAGAAAGCTATTTTTAGG + Intergenic
1078677290 11:13434135-13434157 ATAGTATTAAAACTATTTTTAGG - Intronic
1079322387 11:19462107-19462129 ATATTAAGAAATTTATTTTTCGG - Intronic
1080260068 11:30339592-30339614 GCTGTAATAAAGCTATGTTTTGG + Intergenic
1083440662 11:62673966-62673988 AGTGTTAGAAAGCTTTATTTGGG - Intergenic
1084094716 11:66903437-66903459 ATTTTAAAAAATATATTTTTTGG + Intronic
1085161820 11:74354748-74354770 ACTGTGAAAAAGCTATTTGTTGG + Intronic
1085328900 11:75630631-75630653 ATTTGAAGGAATCTATTTTTAGG - Intronic
1085843644 11:80041784-80041806 ATTTTAAAAAAGATTTTTTTGGG - Intergenic
1087710619 11:101545543-101545565 ATCTCAAGAAAGCTATTTTATGG - Intronic
1091340107 11:134804822-134804844 ATTCTCAGCAAGCTATTTTGTGG - Intergenic
1093240618 12:16667069-16667091 ATAGTTAGATAACTATTTTTGGG + Intergenic
1093445591 12:19253495-19253517 ATAGTAGGAAAGATATATTTAGG + Intronic
1093523068 12:20072935-20072957 TTTGTAAGTAGGCTAGTTTTTGG + Intergenic
1093697171 12:22173965-22173987 ATTGTAAGTTGACTATTTTTTGG + Intronic
1093846002 12:23972321-23972343 ATAGGAAGAAAAATATTTTTAGG - Intergenic
1093916573 12:24808863-24808885 ATGTTAAGAAAGCTGTTTTGTGG + Intergenic
1094447825 12:30551247-30551269 ATAGCAAGAAAGCTACTCTTTGG + Intergenic
1095058776 12:37655618-37655640 ATTCTGAGAAACTTATTTTTGGG + Intergenic
1095165132 12:38963373-38963395 AATCTAAGAAAGATATTTTGAGG - Intergenic
1095859100 12:46895089-46895111 TTTGAAAAAAAGTTATTTTTTGG - Intergenic
1095963507 12:47851021-47851043 TATGTAAGAAAGCTATTTGTTGG + Intronic
1097555504 12:61132734-61132756 ATTGTAAATCAGCTATTTTCAGG - Intergenic
1097773438 12:63617767-63617789 TTTTTAAGGAAGCTATGTTTGGG + Intronic
1098659979 12:73080495-73080517 ATTATAAAAAATCTATTGTTGGG + Intergenic
1099156822 12:79187669-79187691 ATAGTGATAAAGCTATTTCTAGG - Intronic
1099351090 12:81569247-81569269 ATTGTAAGAAATCTAATGCTAGG - Intronic
1099453181 12:82832787-82832809 CTTTTAAAAAAGCTATTTCTTGG - Intronic
1099896419 12:88653733-88653755 ATTGTATTAATGCTTTTTTTTGG + Intergenic
1100344587 12:93715512-93715534 TTTGTCAAAAAACTATTTTTGGG + Intronic
1101413325 12:104487104-104487126 ATGGAAAGAAGGCTATTTTTAGG - Intronic
1102665594 12:114569917-114569939 ATTTTTAGAAAGCTGTTCTTGGG - Intergenic
1104122149 12:125809737-125809759 CTTTTAAGAAAGCTAGTTTGGGG - Intergenic
1104260680 12:127179588-127179610 ATTTTAATAAAACTTTTTTTTGG + Intergenic
1105607755 13:21941358-21941380 ATTTTAAGAAGGCAAGTTTTAGG - Intergenic
1106025493 13:25951869-25951891 TTTGTAGGAATGATATTTTTAGG + Intronic
1107459743 13:40590410-40590432 TTGGAAAGAAAGCTATTTTGGGG - Intronic
1107711789 13:43157833-43157855 AGTGTAAGCAATTTATTTTTAGG + Intergenic
1108823684 13:54385616-54385638 CTTGTAAGAAATCCATTTTCTGG - Intergenic
1108921518 13:55680466-55680488 ATTTTAAGCAAGCAATTATTTGG - Intergenic
1109207273 13:59496507-59496529 ATTCTAAGAAAGCTATGAATCGG - Intergenic
1109214349 13:59570878-59570900 ATGGTAAGAAAGTCAATTTTTGG + Intergenic
1109656437 13:65396995-65397017 TTTTTAAAAAAGATATTTTTAGG + Intergenic
1109844774 13:67973796-67973818 ACTGAAAGAAATTTATTTTTTGG + Intergenic
1110059293 13:71021373-71021395 TTTGTAAGTATGCTATTTTGTGG - Intergenic
1110075983 13:71243649-71243671 AATGTATGAAATCTATTTATAGG - Intergenic
1110198043 13:72813422-72813444 ATTGTGAGACAGCAAGTTTTAGG - Intronic
1110975311 13:81825972-81825994 AATGTAAGCATGTTATTTTTAGG - Intergenic
1111119469 13:83826711-83826733 ATTGTAACAATGCTATATTTTGG - Intergenic
1111427256 13:88103149-88103171 TTTGTTGGAAAGCTATTTATGGG - Intergenic
1112672108 13:101652646-101652668 ATTGTAACAAAGCTCTTGTAAGG - Intronic
1112796655 13:103064524-103064546 ATTATGAGAAAGCTGTTTATTGG + Intronic
1112868778 13:103942453-103942475 ATTGTAAGGAAGGTCTTTTCTGG + Intergenic
1113253724 13:108484761-108484783 ATTGTAAAAAATATATTATTGGG - Intergenic
1113312475 13:109144626-109144648 TTGGTAAGAAAGCTATTTCACGG - Intronic
1115434832 14:33360635-33360657 ATTGTAAGAGAGTACTTTTTTGG - Intronic
1115927901 14:38457353-38457375 ATTGTAAGATAAATATTTTGGGG - Intergenic
1116172705 14:41423419-41423441 ATATTAAGAAATCTATTTTGTGG - Intergenic
1116304462 14:43232835-43232857 ATTTTAACAAAGTCATTTTTGGG - Intergenic
1117535634 14:56700214-56700236 ATTTGAAAAAAGCTTTTTTTTGG + Intronic
1118677869 14:68208034-68208056 ATTGTAGACAGGCTATTTTTAGG + Intronic
1119013192 14:71019242-71019264 ATAGTAAGATAATTATTTTTAGG + Intronic
1119111059 14:71974487-71974509 ATTGAAAGGAAACTAATTTTAGG + Intronic
1123104534 14:105833574-105833596 CTAGTAACAAATCTATTTTTTGG + Intergenic
1126014237 15:44334598-44334620 ATTATAAGAAATTTATATTTTGG + Intronic
1126178172 15:45758095-45758117 TTTGAAAGAAAACTATTTCTGGG - Intergenic
1126370823 15:47945253-47945275 GATGTAACAAAGCTATTTTAGGG + Intergenic
1126498644 15:49320417-49320439 ATTTTAGGAAAGCTGATTTTAGG - Intronic
1126880973 15:53097150-53097172 ATTCTAAGAAATGTATTGTTAGG - Intergenic
1128623227 15:69170926-69170948 AATGTATGAAAGCTATTTGGAGG + Intronic
1128631243 15:69270078-69270100 ATTTTGAGAGAGATATTTTTGGG + Exonic
1130347418 15:83061047-83061069 ATTCTAAGAAAGGCATTGTTCGG + Intronic
1134875492 16:17694717-17694739 AATCTCAGAAAGCTATTTTGAGG - Intergenic
1137224202 16:46486717-46486739 ATTGTAAAAAAGTGAATTTTGGG - Intergenic
1138012271 16:53393735-53393757 TTTGAAAGAAAGCACTTTTTAGG - Intergenic
1138019441 16:53464543-53464565 ATTGTATGAAAGATCTATTTTGG + Intronic
1138588750 16:57987856-57987878 AGGGCTAGAAAGCTATTTTTAGG + Intronic
1138778273 16:59751966-59751988 ATTGACAGAGAGCTATTTCTTGG + Exonic
1139220941 16:65181106-65181128 ATTGGAATAAAACTATTCTTGGG - Intergenic
1140092258 16:71848235-71848257 ATTGTTATAAAGCAACTTTTTGG - Intronic
1141893867 16:86946072-86946094 CCTTTAAGAAAGCTATGTTTGGG + Intergenic
1143048536 17:4102752-4102774 ATTGTAATAAAGTTAATTATTGG - Intronic
1144353365 17:14420945-14420967 ATTCTAAGAATCCTATATTTAGG + Intergenic
1146449156 17:32958468-32958490 ATAATAAGAAAACTATTTTGTGG + Intergenic
1149765692 17:59276123-59276145 ATGGTAAGAAAGTTACTTCTTGG + Intergenic
1150799991 17:68273647-68273669 TTTGTAAAAATGCTATCTTTTGG + Intronic
1151011141 17:70497826-70497848 AATATAAGGAAGCTATTTTAAGG + Intergenic
1151118412 17:71765263-71765285 ATGGTAGGAAAGTTATTTTTTGG + Intergenic
1153312175 18:3687855-3687877 ATTATTATAAAGCTATTGTTTGG - Intronic
1155502805 18:26504063-26504085 ATTGTAAGAACTTTTTTTTTAGG + Intronic
1156217473 18:35014457-35014479 ATTGTATAAAAGCTCTTCTTTGG + Intronic
1156900256 18:42292536-42292558 ATTTTGAGAAAGATACTTTTTGG - Intergenic
1157097983 18:44704126-44704148 ATGGGGAGAAAGCTATATTTGGG - Intronic
1157772026 18:50357522-50357544 ATTCTAAGTAAGCTATGATTTGG + Intergenic
1159192327 18:65062476-65062498 AGTGTGTGAAAGGTATTTTTAGG - Intergenic
1159720339 18:71882234-71882256 ATTGTAAGATGGCCATGTTTAGG + Intergenic
1166018230 19:40000035-40000057 GTTATAAGAAAGCTATGGTTAGG - Intronic
925819385 2:7785026-7785048 ATTGTGGGAATGATATTTTTTGG + Intergenic
926276441 2:11406668-11406690 ATTGTCAGCAGGCTATATTTGGG + Intergenic
926475527 2:13316714-13316736 ATTTAAATATAGCTATTTTTAGG - Intergenic
927459023 2:23281671-23281693 ATTGTTAGGAAGCTATTGTAGGG + Intergenic
927672354 2:25079339-25079361 ATTGTTAGAGATATATTTTTTGG + Intronic
928559548 2:32465481-32465503 ACTATAAGAAGGCTAGTTTTAGG - Intronic
929210207 2:39348489-39348511 ATTATAAGAAAGATATTCATGGG - Intronic
929438010 2:41943249-41943271 ATTTTAAGAAACCATTTTTTGGG - Intronic
929635560 2:43517458-43517480 TTTGTAAGTAAACTATTGTTTGG - Intronic
930287518 2:49449615-49449637 ATCCTTAGAAAGCTACTTTTGGG + Intergenic
930367117 2:50453978-50454000 ATTTCAAGATAACTATTTTTTGG - Intronic
930597919 2:53410893-53410915 ATTTTAAAAAAGCCATTTTCAGG + Intergenic
930788759 2:55300809-55300831 ACTTTAAGAAACCAATTTTTGGG - Intronic
930911873 2:56638622-56638644 TTTCTAAGAAAGCTTTTTTGTGG - Intergenic
930997579 2:57739430-57739452 ATTGTAATAAATCATTTTTTCGG - Intergenic
931587998 2:63849236-63849258 ATTGTAAAAATACTATTTTAGGG + Intronic
931952071 2:67375708-67375730 TTTTAAAGAAAGCTATCTTTTGG + Intergenic
933638613 2:84734690-84734712 ATTCTAAGACAGCTATATTAAGG + Intronic
936749584 2:115625220-115625242 AATGTGAGAAAGATCTTTTTTGG + Intronic
937705265 2:124913124-124913146 TATTTCAGAAAGCTATTTTTGGG - Intronic
937753779 2:125511351-125511373 CTTTTCAGTAAGCTATTTTTAGG - Intergenic
937798021 2:126048545-126048567 TTTGTAATAAAGCTAATATTTGG + Intergenic
938189213 2:129259818-129259840 ATTGTAAGAAATATATAATTCGG - Intergenic
938315258 2:130321398-130321420 AATGTAAGATAATTATTTTTAGG - Intergenic
938810743 2:134850566-134850588 ACATTAAGAAATCTATTTTTTGG - Intronic
938927604 2:136058635-136058657 ATTGGAAGCCAGCTATTTTAAGG - Intergenic
939043502 2:137221590-137221612 ATTTCAAGAAATCTATTCTTAGG + Intronic
939415146 2:141886536-141886558 ATTATAGTAAAGCTACTTTTGGG + Intronic
939600495 2:144183696-144183718 AATGTAAGAAAGTTACATTTGGG - Intronic
939731944 2:145795760-145795782 ATGAGAAGAAAGTTATTTTTAGG + Intergenic
940069265 2:149666834-149666856 AATGTAATAGAACTATTTTTGGG + Intergenic
940101852 2:150049293-150049315 ATTCTGAGAAAGCTTTTTGTAGG + Intergenic
940229109 2:151431289-151431311 ATTCTTAGAAGGCTATTTCTAGG - Intronic
941506807 2:166356497-166356519 AATATAAGAATGCTATTTATGGG - Intronic
941749795 2:169122108-169122130 ATTTTAAAAAATGTATTTTTTGG - Intergenic
942279757 2:174348271-174348293 TTTGTAAGTAAGCTATTTTGGGG - Exonic
942684354 2:178515484-178515506 ATAGTAAGAAGGCCATTTTGGGG - Exonic
942721513 2:178958344-178958366 ATTGTAAACAAGCTATTCTGAGG + Intronic
943025856 2:182627495-182627517 ATTTTAAATAAGCTATTTGTTGG - Intergenic
943036980 2:182759370-182759392 ATTGTAAGTATGTAATTTTTAGG + Intronic
943116410 2:183677562-183677584 ATTTTAATAATGCTATTGTTGGG + Intergenic
943523765 2:188990445-188990467 ATTGTCAGAATCATATTTTTTGG - Intronic
944738718 2:202591136-202591158 AATGTAAGAAAGCAATTTTTAGG - Intergenic
944867651 2:203878399-203878421 ATTGTAAGAAATATATTTCAGGG + Intergenic
945499675 2:210556164-210556186 ATAGTAAAAATGCTATTTGTAGG + Intronic
945569804 2:211452053-211452075 ATAGGAGGAAAGCTATTTCTTGG - Intronic
945905399 2:215587443-215587465 ATTGTAAGACATCCATTTTGGGG + Intergenic
946434356 2:219642030-219642052 ATTGGAAGAATTCTATTTTCAGG + Intergenic
946661892 2:222009794-222009816 ATAATAAGAAAGCCATTTTCAGG - Intergenic
946670272 2:222095557-222095579 ATTTTTAGAAATCTCTTTTTGGG - Intergenic
947068517 2:226259025-226259047 ATTAAAAGAAAGCTAATATTAGG - Intergenic
947101266 2:226623707-226623729 ATTTAAAGAAATCCATTTTTTGG - Intergenic
947109361 2:226701774-226701796 ATTTTAGGAAATCAATTTTTAGG + Intergenic
1172336212 20:34118094-34118116 ATTGTAAGCAATGTAATTTTGGG - Intergenic
1173194103 20:40899824-40899846 GATGAAAGAAAGCTAATTTTTGG - Intergenic
1174032221 20:47638900-47638922 TTTGTAAGAAAGACATTCTTGGG + Intronic
1175201701 20:57282518-57282540 GTTTTAAAAAAGTTATTTTTAGG - Intergenic
1177856784 21:26408375-26408397 ACTGTAAGAAACCTCCTTTTCGG + Intergenic
1178009875 21:28272391-28272413 ATAGAAAGAAAGATATTTCTAGG - Intergenic
1178036386 21:28588223-28588245 GTTGTAAGAAAGCTGATTTGGGG + Intergenic
1178851118 21:36213192-36213214 ATTTTAAGAAGACTATTTGTAGG + Intronic
1179766306 21:43575729-43575751 ATAGGAAGAAAGCTACCTTTAGG - Intronic
1180169049 21:46048240-46048262 ATGGTATGAAAGATCTTTTTGGG + Intergenic
1180795046 22:18599244-18599266 ATTTTAAAAAACATATTTTTTGG - Intergenic
1181226692 22:21396072-21396094 ATTTTAAAAAACATATTTTTTGG + Intergenic
1181251957 22:21538780-21538802 ATTTTAAAAAACATATTTTTTGG - Intergenic
1183140185 22:35930496-35930518 CTTCTAATAAAGCCATTTTTTGG - Intronic
949270140 3:2206145-2206167 ATTGAAACAAGGCTATTTTGAGG + Intronic
950382556 3:12629375-12629397 GTTTTAAGAAATTTATTTTTTGG - Intronic
950760265 3:15216699-15216721 ATATTAAGAAATCTATTTTAAGG - Intronic
951507243 3:23461139-23461161 ATTTTAAGAAAGCAACTTTGGGG - Intronic
951677558 3:25259382-25259404 AATGTAAGAAAAATATTTATTGG + Intronic
952075598 3:29693318-29693340 ATAGTTAGAAAGATATTTTAAGG + Intronic
952461612 3:33532554-33532576 ATTGGAAAAAAGATATTATTGGG + Intronic
952683152 3:36118952-36118974 CTTTTAAGAAAGCTGTATTTGGG + Intergenic
954015343 3:47684412-47684434 ATTAAAATAAAGCTATTATTGGG + Intronic
954834060 3:53449366-53449388 ATTGTAAGAAAGCTTTTTAAAGG + Intergenic
955516093 3:59727914-59727936 ACTGTAAGATATCAATTTTTAGG + Intergenic
955622552 3:60879805-60879827 ATTTTAAATAACCTATTTTTAGG - Intronic
955665764 3:61347828-61347850 ACAGTAAGAAAGCTATTGGTTGG + Intergenic
956391463 3:68777974-68777996 TTTCTAAGAAAGATATTGTTAGG - Intronic
957338790 3:78866028-78866050 ACTGTAACAAAGATATTTCTTGG + Intronic
957681169 3:83438115-83438137 ATTGAAAGAAACCTCTGTTTAGG - Intergenic
957968294 3:87349828-87349850 ATTGGAATAAAGCTATAATTTGG + Intergenic
959375067 3:105579456-105579478 ATCAAAAGAAAGATATTTTTGGG - Intergenic
959446417 3:106445614-106445636 ATTGTGAGCAAGATAATTTTAGG + Intergenic
960482787 3:118213669-118213691 TTAGTAAGAAAGCCATTTTTTGG - Intergenic
960576454 3:119234605-119234627 TTTTAAAGAAAGTTATTTTTAGG + Intronic
962470104 3:135699218-135699240 ATTATAAGAAACTTCTTTTTTGG - Intergenic
962974333 3:140433118-140433140 ATTGGAGGAAAGCTATTTGGGGG + Intronic
963830235 3:149999881-149999903 ACTGTGAGAAAGATATTTGTTGG + Intronic
964018741 3:151980754-151980776 GATGTAAGAAAGCTGTCTTTTGG - Intergenic
964718670 3:159749782-159749804 ATTCTAATAAAGGTATTCTTTGG + Intronic
965047244 3:163595055-163595077 AATTTAAGAAAGCTATTTTAGGG - Intergenic
965239971 3:166183439-166183461 ATTAAAAGAAAGCTATGTTTTGG + Intergenic
965507413 3:169531769-169531791 AGATTAATAAAGCTATTTTTAGG - Intronic
965756049 3:172028384-172028406 AATTTCAGAAAGCTATATTTTGG + Intergenic
965796360 3:172443609-172443631 ATTATGAAAAAGTTATTTTTGGG + Intergenic
966800185 3:183756265-183756287 ATTGTAAGAAACAGATTTTATGG - Intronic
967650078 3:191974782-191974804 AATATAAAAAAGCTATATTTAGG + Intergenic
968468990 4:769033-769055 ATTGTGAGAATGCTGTTATTGGG + Exonic
970450463 4:16161833-16161855 ATAGGCAGAAAGCAATTTTTAGG - Exonic
972949251 4:44298612-44298634 ACTGTAAGGAAGCAAGTTTTAGG - Intronic
972964424 4:44491826-44491848 ATTTTAATAAAGCTATTTAAAGG - Intergenic
973016494 4:45145657-45145679 CTTGTGAGCAAGTTATTTTTAGG - Intergenic
973348350 4:49081462-49081484 ATTGTTAGAAAGCTCTGTTATGG - Intergenic
974344331 4:60659191-60659213 ATTCTTAGAAAACTTTTTTTTGG - Intergenic
975733262 4:77357927-77357949 TTTTTAACAAAGCTATTTATAGG - Intronic
975836412 4:78426869-78426891 AGTGGAAAAAAGCTATTTTCTGG - Intronic
976295798 4:83470478-83470500 ATATTAAGAAAGCCATTTTAAGG - Intronic
976319488 4:83696725-83696747 AGTGTAAGAATGCAATTATTAGG + Intergenic
976521552 4:86033530-86033552 TTTGCAACAAAGCTATTTTCAGG + Intronic
976598898 4:86919718-86919740 TTTCTAAGAAAAATATTTTTAGG - Intronic
976677867 4:87723362-87723384 ATTGTAACAAAGATATTTGGTGG + Intergenic
977137299 4:93321448-93321470 ATGGAAAGAAGGATATTTTTAGG + Intronic
977833989 4:101627243-101627265 ATGAGAAGAAAGCTATTCTTGGG + Intronic
977958682 4:103059616-103059638 ATTGTAAGAAAGCATATATTTGG + Intronic
978203924 4:106056800-106056822 ATGGTAAGCAAACTATTTCTTGG - Intronic
978325488 4:107549113-107549135 ATTTTAAAAATGCTATTTTCTGG - Intergenic
978366155 4:107985005-107985027 ATTGAATGAAAGCCATTTGTAGG - Intergenic
979784555 4:124699359-124699381 CTTATAAGAAAGCAATTTGTTGG - Intronic
979877552 4:125912545-125912567 ATTTGATGAAAGCTATTTTTAGG + Intergenic
980039932 4:127927653-127927675 ACTGTAAGGAACATATTTTTAGG - Intronic
981785958 4:148479882-148479904 ATTGTCAGAAAGCAGTTTTGGGG - Intergenic
983074380 4:163307497-163307519 ATTGTCAGAAAGTTACTCTTTGG - Intergenic
983933641 4:173479751-173479773 TTTGAAAGAAAGCTAACTTTAGG + Intergenic
984125862 4:175809469-175809491 ATTTTAAGAAACATATTTTTTGG - Intronic
985901767 5:2801652-2801674 TTTGTAATGAAGCTATTCTTCGG - Intergenic
987279798 5:16401088-16401110 ATTTTAAGAAATCTTATTTTGGG - Intergenic
987761391 5:22166569-22166591 ATAGTAAAAATGCTATTCTTTGG - Intronic
987933821 5:24436995-24437017 ATTGTAGGAAATCTATTCTCGGG - Intergenic
988002961 5:25372927-25372949 ATTGTATTGCAGCTATTTTTTGG - Intergenic
989397693 5:40975925-40975947 ATTGTAATAAAGCTATTACGAGG + Intronic
989959872 5:50400036-50400058 ATTGTAAGTAAAACATTTTTAGG - Intronic
990255747 5:53966765-53966787 ATTGTCAAATAGCTATTGTTTGG - Intronic
990272615 5:54159892-54159914 ATTGTAACAAAATTAGTTTTGGG + Intronic
990924118 5:60999858-60999880 ATAGTAAGAGATCTAATTTTTGG - Intronic
991896184 5:71400036-71400058 ATAGTAAAAATGCTATTCTTTGG - Intergenic
992500912 5:77342576-77342598 TGTGTAAGAAAGCTTTTTATTGG + Intronic
992698342 5:79313791-79313813 ATTGTTTGTAAGCTATTATTAGG + Intronic
992938235 5:81734587-81734609 ATTGTAAGTTAGCTAGTTATTGG - Intronic
993228099 5:85195401-85195423 ATTATAAAAAAGGTATTTTAGGG - Intergenic
994656832 5:102604588-102604610 TTTGTAAGAATATTATTTTTTGG - Intergenic
995986026 5:118175061-118175083 ATTTTAAGAAATGCATTTTTAGG + Intergenic
996623431 5:125538909-125538931 TTTGTAAGTAAGTTTTTTTTTGG + Intergenic
997906757 5:137824755-137824777 ATTTTAAAAAAGCTATTTCATGG + Intergenic
998742213 5:145217156-145217178 ATTGTAAGTAAGAGATTTATAGG - Intergenic
999741562 5:154558885-154558907 TTTGTAAGTAAGCTATTTTGGGG - Intergenic
1000078570 5:157820422-157820444 ATTGGAAAATAGCTTTTTTTGGG - Intronic
1000161530 5:158602347-158602369 ATATTAACAAAACTATTTTTGGG + Intergenic
1000381073 5:160629920-160629942 ATTGTAAGTAAAGTATTTTCAGG + Intronic
1004078155 6:12364209-12364231 ACTCTAAGGAAGCTATTCTTGGG + Intergenic
1005444532 6:25908053-25908075 TTTGTAGGAGAGCTATGTTTAGG - Intergenic
1005670978 6:28105766-28105788 ATTGTACCAATACTATTTTTTGG + Intergenic
1007001963 6:38321986-38322008 TTTGTTAGAAGGCTCTTTTTAGG - Intronic
1007840638 6:44713154-44713176 ATAGTAGCAAAGCTATTTTAGGG + Intergenic
1009303486 6:62057928-62057950 ATTTTAAGAAAAATATTTTAGGG + Intronic
1010606383 6:77893745-77893767 AATGCAAGAAAGCTTTTTCTGGG + Intronic
1011191527 6:84734585-84734607 ATTGTACAAATGCTTTTTTTAGG - Exonic
1011483312 6:87816635-87816657 GTTGAAAGAAAGCTTATTTTGGG + Intergenic
1011607814 6:89121310-89121332 AGTGTAAGAAAGCTGTTTTCTGG + Intergenic
1011925436 6:92638306-92638328 ATTATAAAAATGCTATTTTGCGG - Intergenic
1011976491 6:93306823-93306845 ATTGTAAGAATGCTTAGTTTTGG + Intronic
1012018876 6:93890446-93890468 ATTTTAAGAAAGATAAATTTTGG - Intergenic
1012798930 6:103800842-103800864 ATAGTTAGAAAACTAATTTTAGG + Intergenic
1014574914 6:123058054-123058076 ATTAGAAGAAAACTATTTTAGGG - Intronic
1014722374 6:124933329-124933351 AAATTAAGAAAGCTAATTTTGGG - Intergenic
1016549603 6:145263507-145263529 GTTGTTAGAAATTTATTTTTAGG - Intergenic
1017031148 6:150223383-150223405 ATTGTAAGAAAAGTGTGTTTAGG + Intronic
1017245552 6:152220712-152220734 ATCCTAAGACAGTTATTTTTGGG + Intronic
1018487743 6:164259035-164259057 ATTGAAATAAAGCTGATTTTAGG + Intergenic
1020058288 7:5133736-5133758 ATTATAAGAAAACTTTTTTGAGG + Intergenic
1020666909 7:11056683-11056705 ATTGAAAGACAAATATTTTTAGG + Intronic
1020756807 7:12212886-12212908 AATGTATGTAATCTATTTTTAGG + Intronic
1021036398 7:15804523-15804545 AATCTCAGCAAGCTATTTTTTGG + Intergenic
1021146965 7:17101069-17101091 ATTGAAAGAAAACTAATTTAAGG - Intergenic
1021436099 7:20617657-20617679 ATTATAAAAATGCGATTTTTGGG - Intronic
1022094946 7:27133572-27133594 ATTTTAAGAAAGCTTTTGTTGGG - Intronic
1022365033 7:29704863-29704885 TTTTTAAGGAAGCTATGTTTGGG - Intergenic
1022652305 7:32288377-32288399 ATTTCAAGGAGGCTATTTTTTGG - Intronic
1022933003 7:35141496-35141518 TTTTTAAGGAAGCTATGTTTGGG + Intergenic
1024681820 7:51698085-51698107 ATTGTAAGATAATTATTTTCCGG - Intergenic
1027741133 7:82007239-82007261 ATTTTTAAAAAGCTATTGTTTGG + Intronic
1027794430 7:82674708-82674730 AAAGAAAGAAAGCTATTTTGGGG - Intergenic
1027859483 7:83558092-83558114 ATATTATGAAAGCTATTATTAGG - Intronic
1029828925 7:103234263-103234285 TTTCTAAGGAAGCTATGTTTGGG + Intergenic
1030577567 7:111309301-111309323 ATTGCAAGAAATCAATTTTTTGG + Intronic
1030781351 7:113604105-113604127 ATTGTAGGTAACATATTTTTAGG + Intergenic
1031109568 7:117591138-117591160 ATTCTAAGAAAGGTACTTCTAGG - Intronic
1031192020 7:118564717-118564739 ATTCTAAGAAATGTGTTTTTAGG - Intergenic
1031669649 7:124527434-124527456 ATTTTTAGAAATCTAATTTTTGG + Intergenic
1031945210 7:127832659-127832681 ATGGTAAGAAAGGCATATTTGGG + Intronic
1033468338 7:141618902-141618924 ATTGTTACATAGCTATATTTTGG - Intronic
1034119326 7:148612520-148612542 GTTGTAAGAATTCTATATTTTGG - Intronic
1035874628 8:3174717-3174739 TTTTTAAGATAGCTATTATTAGG - Intronic
1038399906 8:27275905-27275927 ATGTTAAGCAAGGTATTTTTAGG - Intergenic
1038652474 8:29418086-29418108 ATTTAAAAAAAGTTATTTTTTGG - Intergenic
1038811471 8:30850395-30850417 GTTTTAGGAAAGGTATTTTTAGG - Intronic
1039230082 8:35436413-35436435 AATTTAAGAAAGCTATATTTTGG + Intronic
1039521791 8:38177336-38177358 ATGGTAATAAACATATTTTTTGG - Intronic
1039631041 8:39111392-39111414 AATCTAAGCAAGCTATTTTGTGG - Intronic
1041346863 8:56908236-56908258 TTTGAAAGAAATCTATCTTTTGG + Intergenic
1041367451 8:57123726-57123748 AATGTAAGAAGTCTATTTGTAGG + Intergenic
1041611636 8:59856751-59856773 ATGGGAAGAATGCTGTTTTTGGG - Intergenic
1041653473 8:60324361-60324383 ATTGCAAGAAATTTCTTTTTCGG - Intergenic
1041841251 8:62274253-62274275 TTTGAAAAAAAGCAATTTTTTGG + Intronic
1042018475 8:64343795-64343817 TTTATAAATAAGCTATTTTTTGG - Intergenic
1042410156 8:68456597-68456619 ATTGTATAAGTGCTATTTTTTGG - Intronic
1042410165 8:68456752-68456774 ATTGTATAAGTGCTATTTTTTGG - Intronic
1042460807 8:69065417-69065439 ATTGAAATAAAAATATTTTTAGG + Intergenic
1042886917 8:73562659-73562681 ATTGTAAGAAAGTGTTTTGTGGG - Intronic
1043267438 8:78284440-78284462 ATGATAAGAAAACTATTATTGGG - Intergenic
1043771630 8:84209176-84209198 ATTACAAGAAGCCTATTTTTAGG + Intronic
1043943396 8:86222416-86222438 TCTCTAAGATAGCTATTTTTTGG + Intronic
1044393355 8:91679432-91679454 AATGTAAGAATATTATTTTTAGG + Intergenic
1044787385 8:95809014-95809036 ATAGTAATAAAGCTAATTTATGG + Intergenic
1045468933 8:102493956-102493978 TTTGGAAGAAATCTATTTTGGGG - Intergenic
1046056410 8:109084035-109084057 ATTTGAAGTAAGCTGTTTTTAGG + Intergenic
1046315243 8:112492469-112492491 ATGGTAAGGAACATATTTTTTGG - Exonic
1046337171 8:112805275-112805297 AGTGTGAGAAAGCTGCTTTTCGG - Intronic
1047760722 8:127952112-127952134 ATTGAAAGAATTCTGTTTTTTGG - Intergenic
1048756510 8:137744968-137744990 ATTTTATGAGAGCTCTTTTTTGG + Intergenic
1050751968 9:8949359-8949381 AGTGAAAGGAAGTTATTTTTAGG - Intronic
1050844547 9:10197876-10197898 CTTATCTGAAAGCTATTTTTGGG - Intronic
1051139253 9:13960971-13960993 ATTTTAAAAAATATATTTTTTGG + Intergenic
1051155203 9:14135208-14135230 ACTGTAAAATAGATATTTTTGGG + Intronic
1051213692 9:14773707-14773729 ATTGTAAGAGAGTTATCTATTGG - Intronic
1052924565 9:34004019-34004041 ATTGTTAGAAAGCTATATTTGGG - Intronic
1053605013 9:39648861-39648883 ATTGTGGGAAAGCTATTTATTGG + Intergenic
1054248528 9:62693554-62693576 ATTGTGGGAAAGCTATTTATTGG - Intergenic
1054562642 9:66728080-66728102 ATTGTGGGAAAGCTATTTATTGG - Intergenic
1054859674 9:69936451-69936473 ATTCTAAGAAATTTATTATTAGG + Intergenic
1054962455 9:70983834-70983856 ATTGTTACAAAGATATTGTTTGG + Intronic
1056440520 9:86616492-86616514 ATTGTTAGAAAATAATTTTTTGG - Intergenic
1056618124 9:88186085-88186107 ACTGTAATAAAGCCATTTTTGGG - Intergenic
1057098135 9:92331092-92331114 ATAGTAAGAAAGAGATTTATCGG - Intronic
1058300790 9:103370137-103370159 ATTATAAGACATATATTTTTAGG + Intergenic
1058969498 9:110067529-110067551 ATTTTAAAAAATCTATTGTTGGG - Intronic
1059472787 9:114519325-114519347 ATAATAAGAAATATATTTTTTGG + Intergenic
1059515243 9:114888671-114888693 GTTCTAACAAAGGTATTTTTTGG - Intergenic
1059634694 9:116159458-116159480 ATTGAAAGAAAGGTATTTGAAGG - Intronic
1060570983 9:124640195-124640217 GGTTTAAGAAAGATATTTTTAGG + Intronic
1061109368 9:128557170-128557192 TTTGCAAGAAAGGGATTTTTAGG - Intronic
1188114802 X:26229986-26230008 ATTCTCAGAAAGTTATTTTGTGG - Intergenic
1188830080 X:34885759-34885781 ATTATCAGAAGGCTATTTTTAGG + Intergenic
1189549175 X:42075490-42075512 ATTTTGAGAAAGTTTTTTTTTGG + Intergenic
1191608576 X:63087277-63087299 TTTGTAAGAAGGCTATGTGTAGG - Intergenic
1192624146 X:72710703-72710725 GTGGTATGAAAGGTATTTTTTGG + Intronic
1192800929 X:74464348-74464370 TTTGTACTCAAGCTATTTTTTGG + Intronic
1192837537 X:74817561-74817583 ATGGTAGGAAATCTATTTTCAGG - Intronic
1193405581 X:81097056-81097078 ATAGTAAGAAATTTATTATTAGG - Intergenic
1193407941 X:81125708-81125730 TTTAAAAGAATGCTATTTTTAGG + Intronic
1194171621 X:90592043-90592065 ATTGTAGGAAATTTATATTTGGG + Intergenic
1194549920 X:95284844-95284866 ATTTTAATAAAGATATTTCTGGG - Intergenic
1194687286 X:96937388-96937410 ATTGTGAGAAAGGGATTTGTGGG + Intronic
1194713260 X:97260674-97260696 ATAGTAAAAAAGCAACTTTTGGG - Intronic
1195055681 X:101142206-101142228 ATTGTAAGGCAGCTATTTCAGGG - Intronic
1196131226 X:112158942-112158964 ATTGGAGGAAGGCTATTTTGGGG + Intergenic
1196136605 X:112216633-112216655 ATTGTAGGAAAGCTTTTTATAGG - Intergenic
1196383891 X:115126644-115126666 ATTCTAAGAATGCCATTTTTTGG - Intronic
1196468424 X:115996092-115996114 ATTTTAAAATAGCTCTTTTTTGG + Intergenic
1196768670 X:119272355-119272377 ATGCTAAGAAAACCATTTTTTGG - Intergenic
1197140069 X:123107882-123107904 TTTACAAGAAAGCTATTATTGGG + Intergenic
1197403053 X:126016740-126016762 ATTGTAGGCAAGATATTTTTGGG + Intergenic
1197424414 X:126277791-126277813 ATTTTTAAAAAGCTACTTTTGGG - Intergenic
1200022945 X:153226834-153226856 GTTGTAAAAAAGCGATTTCTGGG - Intergenic
1200517853 Y:4169793-4169815 ATTGTAGGAAATTTATATTTGGG + Intergenic
1202179507 Y:22127470-22127492 ACTGAAAGATATCTATTTTTTGG + Intergenic
1202211854 Y:22458924-22458946 ACTGAAAGATATCTATTTTTTGG - Intergenic
1202579488 Y:26364701-26364723 ACTAAAATAAAGCTATTTTTAGG - Intergenic