ID: 1068633506

View in Genome Browser
Species Human (GRCh38)
Location 10:59322816-59322838
Sequence CAATAATACCTCAAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068633501_1068633506 21 Left 1068633501 10:59322772-59322794 CCACTGACTAAATTGATTCCAGT 0: 1
1: 0
2: 0
3: 9
4: 143
Right 1068633506 10:59322816-59322838 CAATAATACCTCAAAGAGGAGGG No data
1068633503_1068633506 -4 Left 1068633503 10:59322797-59322819 CCAAAAAATAGCTTTCTTACAAT 0: 1
1: 0
2: 2
3: 27
4: 393
Right 1068633506 10:59322816-59322838 CAATAATACCTCAAAGAGGAGGG No data
1068633502_1068633506 3 Left 1068633502 10:59322790-59322812 CCAGTAGCCAAAAAATAGCTTTC No data
Right 1068633506 10:59322816-59322838 CAATAATACCTCAAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068633506 Original CRISPR CAATAATACCTCAAAGAGGA GGG Intronic
No off target data available for this crispr