ID: 1068640570

View in Genome Browser
Species Human (GRCh38)
Location 10:59400940-59400962
Sequence CTATTTAAACAAATGGTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068640570_1068640578 29 Left 1068640570 10:59400940-59400962 CCCAGCACCATTTGTTTAAATAG No data
Right 1068640578 10:59400992-59401014 TGGCTTTGTTAAAGATCAGTTGG No data
1068640570_1068640574 9 Left 1068640570 10:59400940-59400962 CCCAGCACCATTTGTTTAAATAG No data
Right 1068640574 10:59400972-59400994 TCCCCACTGTGTGTTCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068640570 Original CRISPR CTATTTAAACAAATGGTGCT GGG (reversed) Intergenic
No off target data available for this crispr