ID: 1068640574

View in Genome Browser
Species Human (GRCh38)
Location 10:59400972-59400994
Sequence TCCCCACTGTGTGTTCTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068640573_1068640574 2 Left 1068640573 10:59400947-59400969 CCATTTGTTTAAATAGGTATTCT No data
Right 1068640574 10:59400972-59400994 TCCCCACTGTGTGTTCTTGTTGG No data
1068640570_1068640574 9 Left 1068640570 10:59400940-59400962 CCCAGCACCATTTGTTTAAATAG No data
Right 1068640574 10:59400972-59400994 TCCCCACTGTGTGTTCTTGTTGG No data
1068640571_1068640574 8 Left 1068640571 10:59400941-59400963 CCAGCACCATTTGTTTAAATAGG No data
Right 1068640574 10:59400972-59400994 TCCCCACTGTGTGTTCTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068640574 Original CRISPR TCCCCACTGTGTGTTCTTGT TGG Intergenic
No off target data available for this crispr