ID: 1068640578

View in Genome Browser
Species Human (GRCh38)
Location 10:59400992-59401014
Sequence TGGCTTTGTTAAAGATCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068640575_1068640578 -4 Left 1068640575 10:59400973-59400995 CCCCACTGTGTGTTCTTGTTGGC No data
Right 1068640578 10:59400992-59401014 TGGCTTTGTTAAAGATCAGTTGG No data
1068640577_1068640578 -6 Left 1068640577 10:59400975-59400997 CCACTGTGTGTTCTTGTTGGCTT No data
Right 1068640578 10:59400992-59401014 TGGCTTTGTTAAAGATCAGTTGG No data
1068640571_1068640578 28 Left 1068640571 10:59400941-59400963 CCAGCACCATTTGTTTAAATAGG No data
Right 1068640578 10:59400992-59401014 TGGCTTTGTTAAAGATCAGTTGG No data
1068640573_1068640578 22 Left 1068640573 10:59400947-59400969 CCATTTGTTTAAATAGGTATTCT No data
Right 1068640578 10:59400992-59401014 TGGCTTTGTTAAAGATCAGTTGG No data
1068640570_1068640578 29 Left 1068640570 10:59400940-59400962 CCCAGCACCATTTGTTTAAATAG No data
Right 1068640578 10:59400992-59401014 TGGCTTTGTTAAAGATCAGTTGG No data
1068640576_1068640578 -5 Left 1068640576 10:59400974-59400996 CCCACTGTGTGTTCTTGTTGGCT No data
Right 1068640578 10:59400992-59401014 TGGCTTTGTTAAAGATCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068640578 Original CRISPR TGGCTTTGTTAAAGATCAGT TGG Intergenic
No off target data available for this crispr