ID: 1068640668

View in Genome Browser
Species Human (GRCh38)
Location 10:59402636-59402658
Sequence GGTGGGGCCTGATACTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068640661_1068640668 19 Left 1068640661 10:59402594-59402616 CCTTTTTTCATTCTCTCTCTCTT No data
Right 1068640668 10:59402636-59402658 GGTGGGGCCTGATACTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068640668 Original CRISPR GGTGGGGCCTGATACTTGAG TGG Intergenic
No off target data available for this crispr