ID: 1068640993

View in Genome Browser
Species Human (GRCh38)
Location 10:59407671-59407693
Sequence GTGCAAAGTTACAGTTATAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068640993_1068640998 30 Left 1068640993 10:59407671-59407693 CCTATATAACTGTAACTTTGCAC No data
Right 1068640998 10:59407724-59407746 CCCCACTACCCGTCAGCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068640993 Original CRISPR GTGCAAAGTTACAGTTATAT AGG (reversed) Intergenic
No off target data available for this crispr