ID: 1068646227

View in Genome Browser
Species Human (GRCh38)
Location 10:59470900-59470922
Sequence AAAAGGCAGCAGCCCCAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068646225_1068646227 -1 Left 1068646225 10:59470878-59470900 CCTGGACAGGGCATCTCTGTAAA No data
Right 1068646227 10:59470900-59470922 AAAAGGCAGCAGCCCCAATTAGG No data
1068646218_1068646227 21 Left 1068646218 10:59470856-59470878 CCGGACTGCCAGATTGCTCCTCC No data
Right 1068646227 10:59470900-59470922 AAAAGGCAGCAGCCCCAATTAGG No data
1068646220_1068646227 13 Left 1068646220 10:59470864-59470886 CCAGATTGCTCCTCCCTGGACAG No data
Right 1068646227 10:59470900-59470922 AAAAGGCAGCAGCCCCAATTAGG No data
1068646223_1068646227 3 Left 1068646223 10:59470874-59470896 CCTCCCTGGACAGGGCATCTCTG No data
Right 1068646227 10:59470900-59470922 AAAAGGCAGCAGCCCCAATTAGG No data
1068646224_1068646227 0 Left 1068646224 10:59470877-59470899 CCCTGGACAGGGCATCTCTGTAA No data
Right 1068646227 10:59470900-59470922 AAAAGGCAGCAGCCCCAATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068646227 Original CRISPR AAAAGGCAGCAGCCCCAATT AGG Intergenic
No off target data available for this crispr