ID: 1068647149

View in Genome Browser
Species Human (GRCh38)
Location 10:59480505-59480527
Sequence TTCCCAAGGAGCCCTGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068647144_1068647149 18 Left 1068647144 10:59480464-59480486 CCATTTTGACTTCAGGCTAGGCT No data
Right 1068647149 10:59480505-59480527 TTCCCAAGGAGCCCTGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068647149 Original CRISPR TTCCCAAGGAGCCCTGTATT TGG Intergenic
No off target data available for this crispr