ID: 1068647390

View in Genome Browser
Species Human (GRCh38)
Location 10:59482595-59482617
Sequence TTAACCAGATTTCAAAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068647390_1068647393 14 Left 1068647390 10:59482595-59482617 CCCATTCTTTGAAATCTGGTTAA No data
Right 1068647393 10:59482632-59482654 ATTCTCTTTCTGAAAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068647390 Original CRISPR TTAACCAGATTTCAAAGAAT GGG (reversed) Intergenic
No off target data available for this crispr