ID: 1068647391

View in Genome Browser
Species Human (GRCh38)
Location 10:59482596-59482618
Sequence TTTAACCAGATTTCAAAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068647391_1068647393 13 Left 1068647391 10:59482596-59482618 CCATTCTTTGAAATCTGGTTAAA No data
Right 1068647393 10:59482632-59482654 ATTCTCTTTCTGAAAGAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068647391 Original CRISPR TTTAACCAGATTTCAAAGAA TGG (reversed) Intergenic
No off target data available for this crispr