ID: 1068657549

View in Genome Browser
Species Human (GRCh38)
Location 10:59591066-59591088
Sequence CACCTTGCTGTGGCTGCTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068657549_1068657554 22 Left 1068657549 10:59591066-59591088 CCTTAAGCAGCCACAGCAAGGTG No data
Right 1068657554 10:59591111-59591133 ACCAGATTGCACCTTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068657549 Original CRISPR CACCTTGCTGTGGCTGCTTA AGG (reversed) Intergenic
No off target data available for this crispr