ID: 1068657711

View in Genome Browser
Species Human (GRCh38)
Location 10:59591899-59591921
Sequence GCACAGGTGTTAGCGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068657711_1068657715 -5 Left 1068657711 10:59591899-59591921 CCTGGACCCGCTAACACCTGTGC No data
Right 1068657715 10:59591917-59591939 TGTGCTAGCATACGCTGCCCTGG No data
1068657711_1068657718 9 Left 1068657711 10:59591899-59591921 CCTGGACCCGCTAACACCTGTGC No data
Right 1068657718 10:59591931-59591953 CTGCCCTGGGTCCAAAGGACAGG No data
1068657711_1068657717 4 Left 1068657711 10:59591899-59591921 CCTGGACCCGCTAACACCTGTGC No data
Right 1068657717 10:59591926-59591948 ATACGCTGCCCTGGGTCCAAAGG No data
1068657711_1068657716 -4 Left 1068657711 10:59591899-59591921 CCTGGACCCGCTAACACCTGTGC No data
Right 1068657716 10:59591918-59591940 GTGCTAGCATACGCTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068657711 Original CRISPR GCACAGGTGTTAGCGGGTCC AGG (reversed) Intergenic
No off target data available for this crispr