ID: 1068661212

View in Genome Browser
Species Human (GRCh38)
Location 10:59625228-59625250
Sequence TACCGTGTGTTCTCACATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068661209_1068661212 5 Left 1068661209 10:59625200-59625222 CCTTAGCAAGCAGGAATAGAAAA No data
Right 1068661212 10:59625228-59625250 TACCGTGTGTTCTCACATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068661212 Original CRISPR TACCGTGTGTTCTCACATAT GGG Intergenic
No off target data available for this crispr