ID: 1068662308

View in Genome Browser
Species Human (GRCh38)
Location 10:59635292-59635314
Sequence CTGGACTCAGTGGGAACAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068662303_1068662308 10 Left 1068662303 10:59635259-59635281 CCAAGAACAATAGGACTGAGCTA No data
Right 1068662308 10:59635292-59635314 CTGGACTCAGTGGGAACAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068662308 Original CRISPR CTGGACTCAGTGGGAACAAC AGG Intergenic
No off target data available for this crispr