ID: 1068663975

View in Genome Browser
Species Human (GRCh38)
Location 10:59653117-59653139
Sequence TTGGATAAGAATAAGCAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 211}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068663972_1068663975 23 Left 1068663972 10:59653071-59653093 CCAGCGTGGTTTACTGGGAGTTA 0: 1
1: 0
2: 0
3: 1
4: 31
Right 1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG 0: 1
1: 0
2: 0
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068663975 Original CRISPR TTGGATAAGAATAAGCAGGC AGG Intronic
901732013 1:11286848-11286870 TTGGATAGGAATCAGTAGGGTGG + Exonic
904780032 1:32939472-32939494 ATGCATAATAATAAGTAGGCAGG - Intronic
906587439 1:46991752-46991774 TTGGAAAGGAATACGCTGGCCGG + Intergenic
907581194 1:55574285-55574307 TTAGAAAAGAAAAAGAAGGCAGG + Intergenic
910556030 1:88533979-88534001 TTGTATAAGAATTAGCAGGAAGG - Intergenic
911962464 1:104323048-104323070 TTGGCTAAATATAAACAGGCAGG - Intergenic
913412021 1:118562601-118562623 TTGGATATGAATAAGGGGGAGGG + Intergenic
916869127 1:168893408-168893430 CTGGATAGGATTAAGCTGGCAGG - Intergenic
921084802 1:211779552-211779574 TTGTTTAAGACAAAGCAGGCTGG + Intronic
922059691 1:222076300-222076322 TAGAATAAGAATAAGATGGCTGG - Intergenic
922284382 1:224156053-224156075 TTGGATACGGATAAGCAGAGAGG + Intronic
922592575 1:226788678-226788700 TTGAAGTGGAATAAGCAGGCTGG + Intergenic
923548853 1:234945397-234945419 GTGGAAAAGAATGAGTAGGCAGG + Intergenic
923630344 1:235645499-235645521 TTGAATAAGAATGTTCAGGCTGG + Intronic
923691518 1:236198020-236198042 TCGTATAAGAATAGGCAGGCAGG - Intronic
924602291 1:245502230-245502252 TTGAAAAAGAAGAGGCAGGCTGG + Intronic
1066403623 10:35098632-35098654 CTTAATAAAAATAAGCAGGCGGG + Intergenic
1067254880 10:44627637-44627659 TAGGAAAAGAAGCAGCAGGCAGG + Intergenic
1068522501 10:58093311-58093333 TGTGATAAGAAGAAGAAGGCGGG + Intergenic
1068663975 10:59653117-59653139 TTGGATAAGAATAAGCAGGCAGG + Intronic
1070361449 10:75693815-75693837 TTGAATAAAAAAAAGCAGGATGG + Intronic
1071905589 10:90170098-90170120 TTGGATAAGAATAAGAAATATGG + Intergenic
1072871148 10:99121707-99121729 TGGGATAAGTATAAACTGGCAGG + Intronic
1073821524 10:107269995-107270017 TTTGCTAAGAATTAGAAGGCAGG + Intergenic
1073881723 10:107989332-107989354 TTGAATAAGAAAAAGAAAGCTGG + Intergenic
1074372926 10:112914878-112914900 AGGGATAAGAAAAAGCAGGGAGG + Intergenic
1075384192 10:122042810-122042832 TGGTTTAAGAATGAGCAGGCAGG - Intronic
1077763992 11:5137158-5137180 CTGGATAAGAAAAGGCAGCCTGG + Intergenic
1079083791 11:17431215-17431237 TTGGCTGGGAATAAGCAGGGAGG + Intronic
1079782674 11:24627839-24627861 TTGGAGAAGAGTAAGCTGGAGGG - Intronic
1081128241 11:39344688-39344710 TTAAATAAGAATAAGCAGCCAGG - Intergenic
1088617607 11:111646593-111646615 GGGGATAAGAAGGAGCAGGCAGG - Intronic
1088756759 11:112891364-112891386 TTACAGAAGAAGAAGCAGGCAGG + Intergenic
1089300597 11:117496457-117496479 ATAGATAAGAAAATGCAGGCAGG - Intronic
1089427752 11:118393890-118393912 CTGAATTAGAAAAAGCAGGCTGG - Intronic
1090014899 11:123077296-123077318 TTTTATAAGAATAAATAGGCTGG - Intronic
1093821807 12:23628629-23628651 TTGGATAAGAAAAAGGAGTACGG + Intronic
1095743545 12:45632866-45632888 CTGGAGAAGAATAAGCTGGCAGG + Intergenic
1096262621 12:50102669-50102691 ATGGGTAGGAGTAAGCAGGCAGG - Intergenic
1096923773 12:55119109-55119131 TTGGATAAGAAGAGGCATTCTGG + Intergenic
1099783889 12:87236447-87236469 TGGGAGAAAAAAAAGCAGGCCGG + Intergenic
1100688639 12:97014293-97014315 TTGGATCAGAATAAATAGCCAGG + Intergenic
1102603394 12:114050505-114050527 TTGGAAAGGACAAAGCAGGCTGG - Intergenic
1103483513 12:121266785-121266807 TTAGATAAGAACAAACAGCCAGG - Intronic
1103885824 12:124199330-124199352 ATGAAAAAGAATAAGGAGGCTGG - Intronic
1105932596 13:25067042-25067064 TTGGAGGAGAATAAGCAGAGTGG + Intergenic
1109968866 13:69738325-69738347 TTGGAGAAGAAGAAGCACTCTGG - Intronic
1110556158 13:76861629-76861651 TTGTAAAATAATAACCAGGCTGG - Intergenic
1110770703 13:79341172-79341194 TTATATAAGAAGATGCAGGCTGG - Exonic
1112669815 13:101622018-101622040 TGGAATATAAATAAGCAGGCAGG + Intronic
1113897330 13:113774121-113774143 TAGGAAGAGAAGAAGCAGGCGGG - Intronic
1115297513 14:31845841-31845863 TTGGAGAAAAATAAGAAGGGAGG - Intronic
1115435587 14:33369261-33369283 TTGGAGTAGAATAACCAGACTGG + Intronic
1115897305 14:38104754-38104776 TTGCATAAGAATAAGCCTGGGGG - Intergenic
1121096985 14:91224225-91224247 TTGGTTAAGGAAATGCAGGCTGG + Intronic
1122680804 14:103461043-103461065 TTGGTTCAGAATAAGCAGCAAGG - Intronic
1122736033 14:103842673-103842695 TTGGAAAAGAAAAAGTATGCTGG + Intronic
1123767908 15:23500208-23500230 TTGGAAAAAAATAAGAAAGCTGG + Intergenic
1126630195 15:50726961-50726983 TTGGATCATAGAAAGCAGGCAGG - Intronic
1127495047 15:59502878-59502900 TTGTAAAAAAAGAAGCAGGCTGG - Intronic
1129624804 15:77185672-77185694 TTGGAGAAGAGTAGGCAGGAAGG + Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1131837824 15:96408600-96408622 GTGGGTAGGAATAAGGAGGCAGG - Intergenic
1131926619 15:97391622-97391644 TAAGAAATGAATAAGCAGGCCGG + Intergenic
1135281536 16:21157624-21157646 TTAGATAACAAAAAGCTGGCAGG - Intronic
1135327470 16:21536075-21536097 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1135599706 16:23771897-23771919 TGGGTTTAGACTAAGCAGGCAGG - Intergenic
1136337822 16:29622095-29622117 TTAGATAAGAAAAAGGAGGCCGG + Intergenic
1140657052 16:77151738-77151760 TGGGATGAGATTTAGCAGGCTGG - Intergenic
1141389263 16:83650774-83650796 TTCGAAAAGAAAAAGCAGGGTGG + Intronic
1142040574 16:87891169-87891191 TTAGATAAGAAAAAGGAGGCCGG + Intronic
1142715873 17:1746726-1746748 TTGCATAAGAATCACCAGGAGGG - Intronic
1144735039 17:17550668-17550690 TTGAACTAGAATAAGCGGGCTGG - Intronic
1151816986 17:76476202-76476224 TTAGAAAATAACAAGCAGGCAGG - Intronic
1151843501 17:76634559-76634581 TTGGAAAAGAAAAAGCAGAATGG - Intronic
1152982714 18:293751-293773 GTGGATAAGAATAAGAAATCTGG + Intergenic
1158004980 18:52662101-52662123 TTGCATCAGAATCAGCTGGCGGG + Intronic
1158346850 18:56524598-56524620 GTGGATAGGAATGAGCAGGTGGG - Intergenic
1158964883 18:62613737-62613759 TTCTATAAGAATACGCAAGCCGG + Intergenic
1163941753 19:20501763-20501785 TTGTATAGGAATAGTCAGGCTGG + Intergenic
1165204963 19:34175525-34175547 TTGCTTAAGAAAAAGCAGCCGGG - Intronic
1165882987 19:39056644-39056666 AGGGATAAGAACAAGCAGCCAGG - Intergenic
1166510185 19:43402334-43402356 TTACATTAGATTAAGCAGGCAGG + Intronic
1166836932 19:45673121-45673143 ATGGAAAAGAATAAGATGGCCGG + Intronic
1168673669 19:58260580-58260602 AAGAATAAGAATAAGCAGGGAGG - Intronic
925202843 2:1982791-1982813 CTGGATAAGGGTAAGCAAGCTGG - Intronic
927394358 2:22632346-22632368 TAGAATTAGAATAAGCAGCCTGG + Intergenic
927887918 2:26729873-26729895 TTGGCTAGCAACAAGCAGGCTGG - Exonic
928621466 2:33092533-33092555 TGGGATAAAAATCAGAAGGCAGG - Intronic
928644869 2:33341289-33341311 TTGGAGAAGGATGAGCAGGTGGG + Intronic
928940562 2:36723404-36723426 TTGGTGAAGTATAAGCAGGCAGG - Intronic
929158131 2:38806410-38806432 TTGAATAAGAATAAACAGACTGG - Intronic
931074083 2:58689570-58689592 TTGGAGGAGAATAAGCATTCTGG - Intergenic
933664738 2:84955872-84955894 ATGGATAAGAAGTAACAGGCTGG + Intergenic
936253471 2:110887382-110887404 TTGGATAACACTGAGCAGCCGGG - Intronic
936722325 2:115267694-115267716 TAGGAGAAGAATAAGCATGTGGG - Intronic
939094620 2:137820645-137820667 TTGGATAGGAATAATCAAACTGG - Intergenic
940574674 2:155486627-155486649 TAGGATAAGATTTAGCAGGCAGG - Intergenic
941010843 2:160297817-160297839 TTGGAGGAGGATAAGCAGGAAGG + Intronic
942265211 2:174217399-174217421 TTAGATAATAATTAGCAGGTTGG - Intronic
942303105 2:174581396-174581418 TTGAATAAGACAGAGCAGGCTGG - Exonic
947384516 2:229577673-229577695 TTGGATCAGAAAACTCAGGCAGG - Intronic
948336296 2:237209842-237209864 TAGGATAACAATAAAAAGGCAGG + Intergenic
1171178743 20:23075575-23075597 ATGGAAAAGAAAAAGAAGGCCGG + Intergenic
1171726595 20:28627293-28627315 TTGGAGAAGAGCATGCAGGCTGG + Intergenic
1171751661 20:29057320-29057342 TTGGAGAAGAGCATGCAGGCTGG - Intergenic
1171857039 20:30356286-30356308 TTGGAGAAGAACATGCAGGCTGG - Intergenic
1172917212 20:38452083-38452105 TTGGGTAGGAATAAGGAGGGGGG - Intergenic
1173459745 20:43233636-43233658 TGGCATGAGAATTAGCAGGCAGG + Intergenic
1173528895 20:43753320-43753342 CTTGATAAGAATAACCAGTCAGG - Intergenic
1174240593 20:49131544-49131566 TGGAAAAAGAAAAAGCAGGCTGG + Intronic
1175013947 20:55768306-55768328 TTGTAAAAGAATAAACAGGTCGG + Intergenic
1177010605 21:15727012-15727034 TAAGAAAACAATAAGCAGGCTGG - Intergenic
1177022103 21:15874869-15874891 GTCTATAAGAATATGCAGGCTGG + Intronic
1177760580 21:25398614-25398636 GTGGGAGAGAATAAGCAGGCTGG + Intergenic
1179143478 21:38747735-38747757 TAGGATGAGAAGAAGCAGCCAGG + Intergenic
1179797878 21:43796003-43796025 ATAGAAAAGAATTAGCAGGCTGG + Intronic
1182328473 22:29532365-29532387 TCAAATAAGAATAAACAGGCCGG + Intronic
1182960592 22:34470883-34470905 AAGGATAAGAATAAGAAGGAGGG - Intergenic
1183173109 22:36202429-36202451 TTGGTGAAGAAAAATCAGGCCGG + Intronic
1184261109 22:43316912-43316934 TTGGACAAAAACAGGCAGGCAGG + Intronic
949402666 3:3682291-3682313 GTGGATAAGAATAAGAAACCAGG - Intergenic
951682575 3:25309881-25309903 TTGAAGAAGAATAAACAGTCTGG - Intronic
952815327 3:37442511-37442533 TTGGATATGACTAAGCATCCTGG - Intergenic
953987264 3:47454069-47454091 TAAGATAAGAATAGACAGGCCGG + Intronic
954754067 3:52829556-52829578 TTGGAGAAGAACAAGCATGCAGG + Intronic
956768155 3:72501967-72501989 ATGGACAAGAAAAAGCAGGCTGG + Intergenic
957224923 3:77430961-77430983 TGGGAAAAGAATAAGCAGATTGG - Intronic
961613388 3:128159419-128159441 GAGGAGGAGAATAAGCAGGCAGG - Intronic
962102374 3:132356359-132356381 TTGGATAAGAAGTGGGAGGCAGG - Intronic
966305250 3:178525528-178525550 TTGGATAGGAAAAGGCTGGCTGG - Intronic
966712339 3:182982604-182982626 TTGGCTAAGAAATAGAAGGCAGG - Intronic
966810853 3:183843304-183843326 TTAGAAAAAAATAAGCAGTCTGG + Intronic
967050398 3:185778146-185778168 TTGTATTGGAATAAGCAGGTTGG - Intronic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
970652496 4:18193941-18193963 TTGGAGAAATATAAGCAGGATGG + Intergenic
972226475 4:37018643-37018665 TTGAATCAGAACCAGCAGGCAGG + Intergenic
972239480 4:37174840-37174862 TTGGATAAGAGGGAGCAGGGAGG - Intergenic
972597203 4:40540341-40540363 TTTGTTAAAAATAAACAGGCTGG + Intronic
972599839 4:40562397-40562419 TTGCATCAGACTAAGGAGGCGGG + Intronic
972843539 4:42959843-42959865 TTAAATAAGAATCACCAGGCTGG - Intronic
973191488 4:47390879-47390901 TTGGAGAGGAGTAAGCTGGCCGG + Intronic
974247851 4:59344609-59344631 CTGGATAAGAAGTAGCATGCTGG + Intergenic
977789076 4:101076603-101076625 TTGGATAGAAATAAGTATGCAGG + Intronic
979149934 4:117298653-117298675 TTCTATCAGAATAAGCAGGTGGG - Intergenic
979805293 4:124962655-124962677 TTGCATATGAATAAGCATGTAGG + Intergenic
980135886 4:128858151-128858173 CTGGATATGCAAAAGCAGGCAGG - Intronic
985992732 5:3576697-3576719 TTGGGTCAGGATAAGCAGGAGGG + Intergenic
986624091 5:9707217-9707239 TGGGAGAAGAATGAGAAGGCAGG + Intronic
987096336 5:14553894-14553916 TCGGAAAAAAAAAAGCAGGCAGG - Intergenic
987225810 5:15840352-15840374 TTGGAAAAGAATGAGGAGGAGGG - Intronic
987364240 5:17134534-17134556 CTGTATAAGAATATTCAGGCCGG - Intronic
988186682 5:27873380-27873402 CTGAAAAAAAATAAGCAGGCCGG + Intergenic
989020686 5:37003297-37003319 TTGGAGAAGAATATTCAGGATGG + Exonic
989842759 5:46100890-46100912 CTGGATTAGAATAAGCAGATGGG + Intergenic
990169920 5:53036641-53036663 TGGGAGAAAAATAAGCAGGCTGG - Intronic
990850940 5:60204100-60204122 TTGTTTAAGGGTAAGCAGGCAGG + Intronic
990940615 5:61199875-61199897 TTGGAGAAGAATAAGCACTCTGG + Intergenic
991670554 5:69043215-69043237 TTGGATAGGAATAAGACGGAAGG - Intergenic
992376891 5:76197109-76197131 TTACAAAAGAAAAAGCAGGCAGG - Intronic
993253478 5:85557098-85557120 TTGGATAAGAAGAAGCATTCTGG - Intergenic
995713394 5:115057406-115057428 TTGGGTAAGAATCAGCAGGATGG - Intergenic
999552485 5:152704467-152704489 TTGGATAAGAAAATGCTGACTGG + Intergenic
1002207744 5:177575402-177575424 TTGGACCAGTATAAGCATGCCGG + Intergenic
1002885740 6:1292351-1292373 TTGGAAAAGAAGAGGTAGGCTGG - Intergenic
1005454051 6:26001851-26001873 TTGGATAAAAGTCAGTAGGCGGG + Intergenic
1006243500 6:32708133-32708155 TTGGAAAAGATTAATTAGGCAGG - Intergenic
1008015088 6:46509546-46509568 ATGGAAAAGCACAAGCAGGCTGG - Intergenic
1008040446 6:46792258-46792280 TTGAATAAGAATAAGTATTCAGG - Intergenic
1009710865 6:67318091-67318113 TTGGATAAAAGTAAGATGGCAGG + Intergenic
1012247070 6:96937929-96937951 TTGGGGAAGAATTAGAAGGCAGG - Intronic
1013838593 6:114362386-114362408 TTAGAGAAGAAGAAGCAGGTAGG + Intergenic
1013888426 6:114998929-114998951 TTGCATAAGAATAAGCCTGGGGG - Intergenic
1015673999 6:135724445-135724467 TTGGAAAAGATAAACCAGGCTGG + Intergenic
1017139981 6:151181625-151181647 TTATATAAAAATTAGCAGGCCGG - Intergenic
1017250029 6:152270508-152270530 TTCCATTAGAATAATCAGGCAGG - Intronic
1017297357 6:152813614-152813636 TTGGATAAGCAAAAGGATGCTGG + Intergenic
1021260838 7:18455105-18455127 TTGGATAATAAAAAGGAGACAGG + Intronic
1022171351 7:27834991-27835013 TGGGATATTACTAAGCAGGCAGG - Intronic
1022703203 7:32780546-32780568 TTTGCTCAGAATAAGGAGGCTGG + Intergenic
1023088596 7:36597053-36597075 TAGGATAAGAATAAGGATGGAGG - Intronic
1023707616 7:42958309-42958331 TTTTATAAGATTAATCAGGCTGG + Intergenic
1023791485 7:43757260-43757282 TTGCATAAGAAATAGCAGGGAGG + Intergenic
1025016455 7:55442818-55442840 TTGGAAAATAAAAAGCAGGCCGG + Intronic
1026448310 7:70505238-70505260 TTGGATGAGAAAGAGAAGGCTGG + Intronic
1026989291 7:74574296-74574318 TTAAATAAGAATAATGAGGCCGG - Intronic
1028567574 7:92249423-92249445 GTGTATAAGAATAAGCGGCCGGG + Intronic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1030439982 7:109577112-109577134 TTGAATAAGAATTAGTTGGCTGG + Intergenic
1034585084 7:152083663-152083685 TTGGAAAAGAATAAATAAGCAGG - Intronic
1039765173 8:40620921-40620943 TTGGAAATGAATAAGCAGTAGGG - Intronic
1039806539 8:41004831-41004853 TTGGCTCAGAATAGTCAGGCTGG - Intergenic
1040731753 8:50456224-50456246 TTTGATAAGAATCAGCAGTCAGG - Intronic
1042566953 8:70121315-70121337 ATGGATATGATTAAGCAGGAGGG - Exonic
1042810410 8:72819407-72819429 CTTGGTAAGAATAAGTAGGCAGG - Intronic
1043388261 8:79768349-79768371 ATGGAGAAGAATGGGCAGGCGGG + Intergenic
1045524953 8:102933598-102933620 TTGGAGAAGAATCACCAGGATGG - Intronic
1046339049 8:112827426-112827448 ATGGACAAGAAAAGGCAGGCTGG - Intronic
1047613651 8:126545156-126545178 TTGGGGAAGGTTAAGCAGGCAGG - Intergenic
1047808319 8:128381340-128381362 TTGCATAAGAATAAGCCTGGGGG + Intergenic
1048081403 8:131132034-131132056 TAGGATAAGAATAAGCAAGGTGG - Intergenic
1050591837 9:7168766-7168788 TTATATAAGAGTAAACAGGCCGG + Intergenic
1051302146 9:15663455-15663477 AAGAATAAAAATAAGCAGGCAGG - Intronic
1053408321 9:37897349-37897371 ATGAATAATAATAATCAGGCAGG - Intronic
1053591000 9:39514603-39514625 TTGGATGAGATCAAGAAGGCAGG + Intergenic
1053723134 9:40969806-40969828 TTGGAGAAGAGCATGCAGGCTGG - Intergenic
1053848848 9:42269975-42269997 TTGGATGAGATCAAGAAGGCAGG + Intergenic
1054342832 9:63882186-63882208 TTGGAGAAGAGCATGCAGGCTGG + Intergenic
1054575306 9:66850687-66850709 TTGGATGAGATCAAGAAGGCAGG - Intergenic
1054800739 9:69345902-69345924 TTTAATAAGAATAAGAAGGTAGG - Intronic
1057847478 9:98536779-98536801 TTGGAGAGGGATAGGCAGGCAGG - Intronic
1058606077 9:106724849-106724871 TTGAAAAAGTATAAGCAGGCTGG + Intergenic
1059067033 9:111096220-111096242 TTAGATTAGAATCAGCAGGGGGG - Intergenic
1059199586 9:112401741-112401763 TTGGAGAGGAATATACAGGCTGG + Intronic
1059831200 9:118098128-118098150 TTGCATAAGAATTAACAAGCTGG - Intergenic
1060394135 9:123303776-123303798 TTGGGGAAGAATAAGAAGGTTGG - Intergenic
1061691386 9:132334792-132334814 TTGCAAAAGAATAACAAGGCAGG + Intronic
1061704476 9:132442252-132442274 TTCAATAAGAAAAAACAGGCTGG + Intronic
1186311067 X:8319684-8319706 ATGGAGAAGAATAAACAGGCTGG - Intergenic
1187350576 X:18511779-18511801 TGGGACAGGAATAAGAAGGCAGG + Intronic
1187637905 X:21252983-21253005 TTGGAAAAGAAACAGCAGGATGG - Intergenic
1189020121 X:37327079-37327101 TTGGATAACAAAAATCAAGCAGG - Intergenic
1189259908 X:39670892-39670914 GTGGCTAAGAATGAGAAGGCAGG - Intergenic
1190833425 X:54079500-54079522 GTCATTAAGAATAAGCAGGCCGG + Intronic
1191701124 X:64043996-64044018 CTGAAAAAGAGTAAGCAGGCTGG - Intergenic
1192018194 X:67354855-67354877 CTGGATAGGAGTAAGTAGGCTGG - Intergenic
1192192476 X:68999888-68999910 TTGGGGAAGAATCAGCAGGAGGG - Intergenic
1192635320 X:72810227-72810249 TTGGAAAAGAACAAGCATGAAGG - Intronic
1192646394 X:72910576-72910598 TTGGAAAAGAACAAGCATGAAGG + Intronic
1192749132 X:73969979-73970001 ATGGAAAAGAATAAGCAGTCCGG - Intergenic
1192815097 X:74582127-74582149 TTGCATACCAATAAGCTGGCTGG + Intergenic
1194094736 X:89624531-89624553 TTGGATAAGAATGAGCAAATAGG - Intergenic
1195954618 X:110316993-110317015 TTGGATAAAAATAAGTAGTAAGG + Intronic
1196095227 X:111791561-111791583 TTGGATGAGACTCTGCAGGCAGG - Intronic
1200447372 Y:3280689-3280711 TTGGATAAGAATGAGCAAATAGG - Intergenic