ID: 1068664333

View in Genome Browser
Species Human (GRCh38)
Location 10:59657285-59657307
Sequence GTTGGTCCACAAATGCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068664333_1068664336 -5 Left 1068664333 10:59657285-59657307 CCCATAGGCATTTGTGGACCAAC 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1068664336 10:59657303-59657325 CCAACCCCTGTTCACTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068664333 Original CRISPR GTTGGTCCACAAATGCCTAT GGG (reversed) Intronic
902652333 1:17844851-17844873 GGGGTTCCACAAATGCCTAAAGG - Intergenic
905988582 1:42311961-42311983 GATGATTCACAAATGCCTAATGG + Intronic
909329733 1:74396756-74396778 GTTGGTTCTCAAATGCTTTTGGG - Intronic
912350130 1:109004683-109004705 GTTGATGCACAGAGGCCTATCGG - Exonic
915841880 1:159219736-159219758 GTTGGTCAGCAAATTCATATAGG - Intergenic
918134988 1:181663969-181663991 ATTTGCCCACAATTGCCTATAGG - Intronic
918719065 1:187829474-187829496 GTTCGTCAACAAATGAATATAGG + Intergenic
918841153 1:189541224-189541246 GCTTGTCCACGAATGTCTATTGG + Intergenic
922867618 1:228873619-228873641 GGTGCTCTACAAATACCTATGGG - Intergenic
1067514475 10:46925893-46925915 ATGGGTCCACATATGCCTAAAGG - Intronic
1067647784 10:48125920-48125942 ATGGGTCCACATATGCCTAAAGG + Intergenic
1068664333 10:59657285-59657307 GTTGGTCCACAAATGCCTATGGG - Intronic
1068799264 10:61121056-61121078 GTTGTTCTACAAATGCCTTTGGG + Intergenic
1068811084 10:61256915-61256937 GCTGGCCCAAACATGCCTATAGG + Intergenic
1071896661 10:90075611-90075633 GTTGGTCCAGAGATGCCTTTTGG + Intergenic
1074947759 10:118297651-118297673 GTTGGTCCACCCTTGCCTGTAGG + Intergenic
1077096942 11:803062-803084 CTTGGTCCACAGCTGCCTCTTGG - Intronic
1084249984 11:67890305-67890327 GTTGGGACACTAATGCCCATGGG - Intergenic
1087206847 11:95405163-95405185 GTTTGTACACAAATGCTTATAGG - Intergenic
1090180367 11:124692974-124692996 GTTGTTCCACAATTGCCATTGGG + Intronic
1090868585 11:130723501-130723523 GTGGGTCCACAAAGCCCTAGAGG - Intergenic
1099268212 12:80475563-80475585 GTTAGACCACAAATTCTTATGGG - Intronic
1100922624 12:99505565-99505587 ATTGGTCAACAAATACTTATTGG + Intronic
1101827723 12:108233438-108233460 GGTGCTCCACAAATGCATGTTGG - Intronic
1102257648 12:111425396-111425418 GTTGGTCAGCAAAGGCCTCTTGG + Intronic
1102466278 12:113132611-113132633 ATAGATCCACAAATGCCTCTGGG + Intronic
1112435730 13:99390126-99390148 GTTGGCCCTCAAATTCCTCTTGG + Intergenic
1112670833 13:101636163-101636185 GTTGGTCAACAGATTCCTAATGG + Intronic
1120674190 14:87401232-87401254 TTTGGTCCTCAAAAGCTTATTGG + Intergenic
1127135682 15:55920792-55920814 GTTACTCCACCAATGGCTATAGG + Intronic
1127958800 15:63875688-63875710 GATGCTCAATAAATGCCTATTGG + Intergenic
1131676049 15:94671883-94671905 CTTGCTCAGCAAATGCCTATTGG + Intergenic
1133422651 16:5660046-5660068 GTTGGTCTAACAAAGCCTATGGG - Intergenic
1133886125 16:9829446-9829468 CTTGGTCCACAAATTCCTCTTGG + Exonic
1148515132 17:48209966-48209988 GTTGAACTACAAATGCCTCTGGG + Intronic
1150871094 17:68911469-68911491 GTGGGTCCAGAAATGCCTTCTGG - Intronic
1153087728 18:1307701-1307723 CTTGGTTTACAAATGCCTCTTGG + Intergenic
1153439461 18:5100748-5100770 GGAGGTCCTCAAATGCCTGTGGG + Intergenic
1164189110 19:22899209-22899231 GTGGCTCCACAAAGGGCTATGGG - Intergenic
926710370 2:15874771-15874793 TTTTATCCACAAAAGCCTATGGG - Intergenic
928559926 2:32471203-32471225 GTTGTTCCAGAACTGGCTATTGG + Intronic
929844356 2:45506738-45506760 CTTGGTCTTCAAATGACTATGGG - Intronic
931476949 2:62597845-62597867 TTTGGTCAACAGATACCTATTGG + Intergenic
944616318 2:201464701-201464723 GTGGGTCCAGAAATGCCTTCTGG + Intronic
945065153 2:205941978-205942000 GTTGGACCCCAAATGCATAAGGG - Intergenic
1170072282 20:12381761-12381783 GCTGTTCCTCAAATGCCCATTGG + Intergenic
1170158958 20:13293553-13293575 AATGTTCCTCAAATGCCTATTGG + Intronic
1172200065 20:33119335-33119357 GGAGGTCCCCAAATGCCAATGGG + Intergenic
1173262892 20:41452164-41452186 GGTGGTCCTCAAAGGCCTTTCGG - Intronic
1173888627 20:46484602-46484624 GTTAGTTCACAACTGCCCATGGG + Intergenic
1174443257 20:50573136-50573158 ATAGAACCACAAATGCCTATTGG - Intronic
1179083123 21:38191746-38191768 GCTGGTATACAAATGCCTTTTGG + Intronic
952594698 3:35001803-35001825 GTTACTCAACAAATGCATATAGG - Intergenic
953456636 3:43047551-43047573 GTTGGTCCACTGATTGCTATTGG + Intronic
956798953 3:72739601-72739623 CTTGCTCCACAAGTGCCTGTGGG - Intergenic
956883824 3:73538006-73538028 TTTGGTCCAGAAATCCCTGTTGG - Intronic
962807920 3:138939834-138939856 GTTTCTCCACAAAGGCCTAGGGG + Intergenic
965896952 3:173589692-173589714 GGTTCTCAACAAATGCCTATTGG + Intronic
969157182 4:5221360-5221382 GTTGGTGGCCAAATTCCTATAGG + Intronic
977074151 4:92432355-92432377 GTGGGTCCAGAAATGCCGTTTGG + Intronic
980674088 4:136051510-136051532 GTTGGTCTGCAATTGACTATGGG + Intergenic
981614013 4:146627464-146627486 GTTAGTCAACAAATACATATCGG + Intergenic
990328696 5:54703854-54703876 TATGGTCCGTAAATGCCTATCGG + Intergenic
998940652 5:147279455-147279477 GGAGGTCCCCAAATGCCTCTGGG + Intronic
1004086283 6:12452715-12452737 ATTGGTCAAAAAATGCCAATTGG - Intergenic
1007948134 6:45844326-45844348 GTTAGGCCAAAAATGCCTTTTGG + Intergenic
1014647861 6:123997500-123997522 CTTGTTCCACAAATGACTGTTGG - Intronic
1014981802 6:127953770-127953792 GTTGGCAAACAACTGCCTATGGG - Intergenic
1018162101 6:161054896-161054918 CTGGGTCCACAAATGGATATGGG - Intronic
1022241721 7:28518646-28518668 GTTGGTCTCCAAATGGCTAGAGG + Intronic
1022325445 7:29326809-29326831 GGTGTTCCACAAATGCTTGTTGG + Intronic
1023035521 7:36128209-36128231 GTTGTTTCACATTTGCCTATAGG + Intergenic
1023569425 7:41556658-41556680 ATGGGTCCTCAGATGCCTATGGG - Intergenic
1029198125 7:98820732-98820754 GTGGGTCCACAGGTGCCTATGGG - Intergenic
1032291780 7:130595786-130595808 GGGGGTCCCCAAATGCCGATGGG - Intronic
1032635677 7:133705534-133705556 TTTGGACCACAATTGACTATGGG - Intronic
1034369715 7:150584340-150584362 AAAGGTCCACAAATGCCAATGGG - Intergenic
1035040373 7:155922314-155922336 GTGTGTCCAAAAATGCCTGTGGG + Intergenic
1035858629 8:3004302-3004324 GTTGCTACACAATTGCCTGTTGG - Intronic
1037442420 8:18929709-18929731 GTTAGTCCTCAAATGTCTGTTGG - Intronic
1037610509 8:20472336-20472358 GTTGGTCCACCACAGCCTTTGGG - Intergenic
1045003654 8:97899303-97899325 GGTATTCCATAAATGCCTATAGG + Intronic
1045500700 8:102742420-102742442 GGTGCTCAATAAATGCCTATTGG + Intergenic
1046799644 8:118411896-118411918 GTTGGTCAACTACAGCCTATGGG + Intronic
1049605961 8:143529319-143529341 GTTTGGCCACAGATGCTTATGGG - Intronic
1050182346 9:2934505-2934527 ATTGGTCCACAGGTGGCTATGGG - Intergenic
1052521601 9:29554779-29554801 GTTCTTCAACAAATGCTTATGGG - Intergenic
1057406979 9:94781321-94781343 TTTATTCCACAAATGCATATTGG - Intronic
1061886197 9:133592173-133592195 GGTGCTCCATAAATGCCTGTGGG + Intergenic
1194113264 X:89865238-89865260 TTTGGGCCACAAAAGCCTCTGGG + Intergenic
1195613175 X:106892128-106892150 GCTGTTCCACATATGTCTATTGG + Intronic
1200465949 Y:3520301-3520323 TTTGGGCCACAAAAGCCTCTGGG + Intergenic