ID: 1068667783

View in Genome Browser
Species Human (GRCh38)
Location 10:59695806-59695828
Sequence AAGGACACTGATGTTGACCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068667783_1068667788 -1 Left 1068667783 10:59695806-59695828 CCGAGGTCAACATCAGTGTCCTT No data
Right 1068667788 10:59695828-59695850 TGGGCTGCTTTAGGTACATATGG No data
1068667783_1068667786 -10 Left 1068667783 10:59695806-59695828 CCGAGGTCAACATCAGTGTCCTT No data
Right 1068667786 10:59695819-59695841 CAGTGTCCTTGGGCTGCTTTAGG No data
1068667783_1068667790 6 Left 1068667783 10:59695806-59695828 CCGAGGTCAACATCAGTGTCCTT No data
Right 1068667790 10:59695835-59695857 CTTTAGGTACATATGGAGGAAGG No data
1068667783_1068667789 2 Left 1068667783 10:59695806-59695828 CCGAGGTCAACATCAGTGTCCTT No data
Right 1068667789 10:59695831-59695853 GCTGCTTTAGGTACATATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068667783 Original CRISPR AAGGACACTGATGTTGACCT CGG (reversed) Intronic
No off target data available for this crispr