ID: 1068667790

View in Genome Browser
Species Human (GRCh38)
Location 10:59695835-59695857
Sequence CTTTAGGTACATATGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068667783_1068667790 6 Left 1068667783 10:59695806-59695828 CCGAGGTCAACATCAGTGTCCTT No data
Right 1068667790 10:59695835-59695857 CTTTAGGTACATATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068667790 Original CRISPR CTTTAGGTACATATGGAGGA AGG Intronic
No off target data available for this crispr