ID: 1068668883

View in Genome Browser
Species Human (GRCh38)
Location 10:59704413-59704435
Sequence GTTGAGAGACGTCATGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068668877_1068668883 23 Left 1068668877 10:59704367-59704389 CCACTTATCTTATTCAATCCCTC 0: 1
1: 0
2: 0
3: 22
4: 226
Right 1068668883 10:59704413-59704435 GTTGAGAGACGTCATGCTAAAGG No data
1068668882_1068668883 -7 Left 1068668882 10:59704397-59704419 CCATGAGGAAACTGAAGTTGAGA 0: 1
1: 0
2: 14
3: 65
4: 423
Right 1068668883 10:59704413-59704435 GTTGAGAGACGTCATGCTAAAGG No data
1068668876_1068668883 26 Left 1068668876 10:59704364-59704386 CCACCACTTATCTTATTCAATCC 0: 1
1: 0
2: 1
3: 5
4: 159
Right 1068668883 10:59704413-59704435 GTTGAGAGACGTCATGCTAAAGG No data
1068668880_1068668883 4 Left 1068668880 10:59704386-59704408 CCTCAATCTACCCATGAGGAAAC 0: 1
1: 2
2: 27
3: 275
4: 2092
Right 1068668883 10:59704413-59704435 GTTGAGAGACGTCATGCTAAAGG No data
1068668879_1068668883 5 Left 1068668879 10:59704385-59704407 CCCTCAATCTACCCATGAGGAAA 0: 1
1: 0
2: 2
3: 64
4: 507
Right 1068668883 10:59704413-59704435 GTTGAGAGACGTCATGCTAAAGG No data
1068668881_1068668883 -6 Left 1068668881 10:59704396-59704418 CCCATGAGGAAACTGAAGTTGAG 0: 1
1: 1
2: 39
3: 147
4: 624
Right 1068668883 10:59704413-59704435 GTTGAGAGACGTCATGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068668883 Original CRISPR GTTGAGAGACGTCATGCTAA AGG Intronic
No off target data available for this crispr