ID: 1068670576

View in Genome Browser
Species Human (GRCh38)
Location 10:59718474-59718496
Sequence CACAGTGACAGATTTGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068670576_1068670580 25 Left 1068670576 10:59718474-59718496 CCTCAACCAAATCTGTCACTGTG 0: 1
1: 0
2: 0
3: 24
4: 200
Right 1068670580 10:59718522-59718544 TCCAAGTCTACAGAGAGGTATGG No data
1068670576_1068670579 20 Left 1068670576 10:59718474-59718496 CCTCAACCAAATCTGTCACTGTG 0: 1
1: 0
2: 0
3: 24
4: 200
Right 1068670579 10:59718517-59718539 ATGTTTCCAAGTCTACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068670576 Original CRISPR CACAGTGACAGATTTGGTTG AGG (reversed) Intronic
900286976 1:1906505-1906527 CTGAGTGACAGATTTGCTGGTGG + Intergenic
901139518 1:7019365-7019387 AAGAGTGAGAGATTGGGTTGGGG + Intronic
903138525 1:21324808-21324830 CCCAGTGACACACTCGGTTGGGG - Intronic
903666337 1:25009773-25009795 CCCAGAGACAGACTTTGTTGTGG + Intergenic
904824932 1:33268259-33268281 CACAGTGCCAGAGTGGGTGGAGG + Intronic
905881555 1:41467457-41467479 CACAGTGTCAGTTTGGGTTGTGG - Intergenic
906331998 1:44893479-44893501 AACAGTGATGGATTTTGTTGAGG + Intronic
907109941 1:51918044-51918066 CACAGGGACATATTTTGTTTTGG - Exonic
908601631 1:65745434-65745456 CACAGGGACAGAATTGGTTAAGG + Intergenic
908768052 1:67571840-67571862 CACAGTGACAGGCATGTTTGTGG + Intergenic
910473739 1:87583577-87583599 CACAGTGGCATCTTTGGTTAAGG - Intergenic
911328577 1:96498616-96498638 CACAGTGTGAGATGTGGTTGTGG - Intergenic
911448591 1:98034243-98034265 CCCAGGGACAGATTTGTTTATGG - Intergenic
913542102 1:119831348-119831370 CACAAGGACAGATAGGGTTGGGG + Intergenic
914863555 1:151406374-151406396 CACAGTGGCAGCTTTGTTAGTGG + Exonic
915380811 1:155438460-155438482 CACAGTTACAGATGTAATTGAGG - Exonic
915917599 1:159950333-159950355 CACAGAGACAGGGTGGGTTGGGG - Intergenic
917621348 1:176799864-176799886 CACCCTGACAGATGTGGTTCAGG - Intronic
921446212 1:215250022-215250044 TACAATGACAGCTTTGGTTGAGG - Intergenic
922552855 1:226509638-226509660 CACAGTGTAAGATTTCTTTGTGG + Intergenic
1063053148 10:2475324-2475346 CACAGTTACAGAGTTGATGGTGG - Intergenic
1063111017 10:3037483-3037505 CCCAGTGAAAGAGATGGTTGGGG + Intergenic
1063150282 10:3330705-3330727 CAGAATCACAGATTTGGTGGAGG - Intergenic
1066698068 10:38095718-38095740 GACATTGACACATTTTGTTGTGG + Intronic
1066994445 10:42551466-42551488 GACATTGACACATTTTGTTGTGG - Intergenic
1067304359 10:45046990-45047012 TAAAGTGACACATATGGTTGTGG - Intergenic
1068670576 10:59718474-59718496 CACAGTGACAGATTTGGTTGAGG - Intronic
1068844501 10:61656825-61656847 CACTGTAACAGATTTTGTGGAGG + Intergenic
1068865193 10:61887582-61887604 GACAGTTACAGATTTCTTTGTGG - Intergenic
1069618384 10:69820752-69820774 CACAGTGACAGATGGGATGGGGG - Intronic
1071093461 10:81946906-81946928 TACAGTTACAGATTAGGTTTTGG - Intronic
1074535496 10:114325810-114325832 GACAGTGACAGACTTGCCTGTGG + Intronic
1075666482 10:124234178-124234200 CACAGTGACAGAGTGGGTGGGGG + Intergenic
1076084387 10:127612518-127612540 TACATGAACAGATTTGGTTGAGG - Intergenic
1077767614 11:5178093-5178115 CACATTGCCAGATTGGCTTGTGG - Exonic
1077919923 11:6634117-6634139 CACAGTGACAGCTGTGGATGGGG - Exonic
1078312423 11:10258338-10258360 CACAGTGGGAGGTTTGTTTGAGG - Intronic
1079492059 11:21000098-21000120 CACAGTGAAAGATGTGGATCTGG + Intronic
1080053578 11:27882267-27882289 CACTTTGAAAGATTTGGGTGTGG + Intergenic
1080839534 11:35971267-35971289 CCCAGTGAAAGATTTTATTGAGG + Intronic
1081625760 11:44654210-44654232 CAAAGAGACAGACTTGGTTGGGG + Intergenic
1083291260 11:61691541-61691563 CACAGGGCCAGGTTGGGTTGGGG - Intronic
1086415653 11:86586682-86586704 CAGAGAAACAGATTTTGTTGTGG + Intronic
1086658838 11:89389827-89389849 CAAAGTCACACATTTAGTTGAGG - Intronic
1087706892 11:101503585-101503607 CACAGTGATAGATGCTGTTGAGG - Intronic
1087906408 11:103703122-103703144 CACAGTGACTAATGTGTTTGTGG - Intergenic
1096193539 12:49634709-49634731 GACAGTGATAGATTGGGTTGGGG + Intronic
1097622117 12:61951787-61951809 CACAGTGATTAATTTGGTAGAGG - Intronic
1098206971 12:68121311-68121333 CACAGTTTCAGAGTTGGTGGTGG - Intergenic
1098260875 12:68669472-68669494 CACCGTGCCAGACTTGGGTGAGG + Exonic
1098905492 12:76157631-76157653 CGAAGTGAGAGAATTGGTTGAGG + Intergenic
1106676295 13:31962123-31962145 CACAGTGACTGGTTTAGTTAAGG + Intergenic
1107252538 13:38381268-38381290 CAGAGTGACAGATGTTTTTGAGG + Intergenic
1107628177 13:42312601-42312623 AACAGTGACAGGTATGGGTGAGG - Intronic
1109217422 13:59605494-59605516 CTGTGTTACAGATTTGGTTGAGG - Intergenic
1110990044 13:82029215-82029237 CATAGTGACAAATTTGCTTTCGG + Intergenic
1111320179 13:86616729-86616751 CAAGATGACAGATTTGGGTGGGG + Intergenic
1113334286 13:109363400-109363422 CAGCATGACTGATTTGGTTGAGG + Intergenic
1113844679 13:113380058-113380080 CATAGCCACAGATTTGTTTGCGG + Intergenic
1113897845 13:113777141-113777163 CACAGAAACAGATCTGGCTGTGG - Intronic
1114791129 14:25659706-25659728 ATCAGTGTCAGATTTTGTTGTGG + Intergenic
1117240177 14:53824292-53824314 CACAGCCAAACATTTGGTTGAGG - Intergenic
1118121154 14:62844831-62844853 CACAGTGATTAATTTGCTTGTGG + Intronic
1118501157 14:66363797-66363819 CACACTGACAGAGATGGTTATGG + Intergenic
1119157542 14:72424823-72424845 CACAGGGAAAGTTTTGGTTCTGG - Intronic
1119394435 14:74315946-74315968 CCCAGTGACTGATTGGGGTGGGG - Intronic
1120498473 14:85264477-85264499 TACAGTCACAGATTTGCATGTGG - Intergenic
1122695260 14:103549320-103549342 CACAGGGACAGAAATGGATGCGG - Intergenic
1125343714 15:38698426-38698448 CCCAGTGACAGATGTGTCTGTGG + Exonic
1126352421 15:47758424-47758446 GCAAGTGACAGTTTTGGTTGAGG + Intronic
1129767213 15:78177886-78177908 CACAGAGACAGAAATAGTTGGGG - Intronic
1129905423 15:79183826-79183848 CACAGTGACAAAGTTGGGAGAGG + Intergenic
1131679153 15:94703198-94703220 CACAGTGACAGACTTCATGGAGG + Intergenic
1137628554 16:49924910-49924932 CCTAGTGACAGATTTTGTTGGGG - Intergenic
1141165861 16:81660685-81660707 CACACAGACAGATACGGTTGTGG + Intronic
1143202848 17:5123826-5123848 CACACATACAGAGTTGGTTGAGG + Intronic
1144537124 17:16101474-16101496 CACAGAGTCAGCTTTGGTAGCGG + Exonic
1146845966 17:36182403-36182425 CACACATACAGAGTTGGTTGAGG - Intronic
1148983073 17:51596044-51596066 CAGTGGGCCAGATTTGGTTGAGG + Intergenic
1149684493 17:58527628-58527650 CCCAGGGTCAGATTTGGGTGTGG - Intronic
1149849166 17:60025331-60025353 CACACATACAGAGTTGGTTGAGG - Intergenic
1149861002 17:60121193-60121215 CACACATACAGAGTTGGTTGAGG + Intergenic
1153999048 18:10467992-10468014 CACAATGACAGATTTAGGTGAGG - Intronic
1156201123 18:34833386-34833408 CACAGTGACACAATGGGTTCTGG - Intronic
1156500614 18:37555036-37555058 CACAGTGATTGATATGATTGGGG + Intronic
1158706903 18:59800875-59800897 TACTGTGACAGGTTTGGTAGGGG - Intergenic
1159665611 18:71156457-71156479 CACAGTGGAAGATGTGATTGTGG - Intergenic
1160445264 18:78922498-78922520 GACAGTGACAGGTGTGGGTGTGG - Intergenic
1160825672 19:1079569-1079591 CACAGTGGGAGACTTGCTTGAGG - Intronic
1164436955 19:28238844-28238866 CACAGAAATAGATTTGATTGGGG + Intergenic
1166581623 19:43905425-43905447 CTCAGTGACTGATATGGTTTGGG + Intergenic
1166714204 19:44956018-44956040 CACAGGGACTGGTATGGTTGTGG + Intronic
1167822413 19:51940690-51940712 CACCTGGACAGATTTGGCTGTGG - Exonic
1168164621 19:54538155-54538177 CACAGTCTCAGATGTGGATGGGG - Intronic
927758257 2:25726084-25726106 CAAGGTGAGAGAATTGGTTGAGG - Intergenic
928587046 2:32770455-32770477 CGTAATGGCAGATTTGGTTGAGG + Intronic
928616043 2:33040562-33040584 AGCAGTGACATATGTGGTTGAGG - Intronic
929460363 2:42098770-42098792 CACAGTGACAGCATTGGTTCCGG - Intergenic
929539454 2:42809105-42809127 CACAGTAACAGATTGTGTTAGGG - Intergenic
930011913 2:46943793-46943815 CACAGTTACAGAATTGGGAGAGG + Intronic
934527702 2:95061901-95061923 CACACTGACAGCTGTGGTTCTGG + Intergenic
936572634 2:113629043-113629065 CACCGTGACAGATTGGGTAAAGG + Intronic
936601216 2:113896760-113896782 CACAGTGACTGATTGGCTCGTGG + Intronic
941815723 2:169794051-169794073 CACAATGACAAAATTGGTTTAGG + Intronic
942238621 2:173938136-173938158 CACAATTACAGAATTGGTAGAGG + Intronic
942659422 2:178248332-178248354 TACAATTTCAGATTTGGTTGTGG + Intronic
943243414 2:185416370-185416392 CAAAGTGACAAATGTAGTTGAGG - Intergenic
945504530 2:210622397-210622419 CACAGAAACAGGTTTGCTTGGGG + Intronic
1169622478 20:7523518-7523540 TACAGTGACAGATTTATTGGAGG + Intergenic
1169767283 20:9160511-9160533 CACAGGCACATATTTTGTTGTGG - Intronic
1172921252 20:38484237-38484259 TGCAGTGACAGATTTGGTAGAGG - Intronic
1173415774 20:42854482-42854504 CACTGTGACAGAATGGGTGGGGG + Intronic
1173585325 20:44177802-44177824 GACAGTGACAGCTATGGTTCAGG + Intronic
1174055316 20:47794571-47794593 CACAGAAGCAGTTTTGGTTGCGG + Intergenic
1174584189 20:51594673-51594695 CACAGTGACAGAATTCATTCAGG - Intergenic
1177798712 21:25806389-25806411 CACAGTGAAAAATATGGGTGTGG - Intergenic
1178291703 21:31374001-31374023 TAGAGTGACAGATGTGGTGGGGG - Intronic
1179653399 21:42829934-42829956 CACACTAACATATTTGGTGGTGG + Intergenic
1180240957 21:46505127-46505149 CAGAGTGTCAGATTTTGTTGAGG + Intronic
1180317206 22:11285493-11285515 CACAGGGACAGATTTCTTCGTGG + Intergenic
1181407483 22:22695071-22695093 CACAGTGACAGAGGTAGATGGGG + Intergenic
1183734615 22:39636938-39636960 CATAGTGACAGGTTGGGCTGAGG - Intronic
1185427556 22:50781836-50781858 CACCGTGACAGATTGGGTAAAGG - Intronic
949763659 3:7500945-7500967 CAGTTTGACTGATTTGGTTGAGG - Intronic
949919866 3:8992131-8992153 CACTGTGACTGATTTTTTTGGGG + Intronic
950655164 3:14432047-14432069 CACAGTGACAGAGTTGGGGCTGG + Intronic
951146330 3:19232300-19232322 CTCAGTGAAGGATATGGTTGAGG - Intronic
953129075 3:40120608-40120630 CACACTGACTGATATGGTTGAGG + Intronic
953691478 3:45123640-45123662 CAGAGTGGCAGAATTGGTGGGGG - Intronic
954455642 3:50597992-50598014 CAAAGTGACAGGATTGCTTGAGG - Intergenic
954657538 3:52205215-52205237 CACAGAGACATCCTTGGTTGTGG + Intronic
956212097 3:66812619-66812641 CACAGTGGCAGAAGTGGATGTGG - Intergenic
956638600 3:71392329-71392351 CACAGTGACAGAGGTGTCTGAGG + Intronic
956903957 3:73746170-73746192 CACAGTGTGAAATTTTGTTGAGG - Intergenic
957812834 3:85249200-85249222 CACAGTAAGAGATGTGGTTTGGG - Intronic
960450299 3:117798705-117798727 CACAGTTACAGATTTTCTGGTGG + Intergenic
962275415 3:134009884-134009906 CACAGTGACAGATCTGGAATTGG - Intronic
962812168 3:138968876-138968898 CACTGTGAGAGATGGGGTTGTGG + Intergenic
967175310 3:186857495-186857517 CACAGTCTCACATCTGGTTGGGG + Exonic
967221223 3:187249695-187249717 CACAGTCACAGAGTTGGTTAGGG + Intronic
969216299 4:5724911-5724933 CACATAGACACATTGGGTTGGGG - Intronic
973291617 4:48476817-48476839 CTCAGTGACTGATTTGGAGGTGG - Intergenic
973655161 4:53039567-53039589 CCCAGTGAGAAATTTGGTTAGGG - Intronic
975345207 4:73285410-73285432 CACAGTCAAGCATTTGGTTGAGG + Intergenic
976854845 4:89591316-89591338 CACAGTGGCAGTGGTGGTTGTGG + Intergenic
977887161 4:102265539-102265561 GGCACTGACAGATTTGCTTGAGG + Intronic
978200154 4:106016472-106016494 CACAGTGACAGAGGTGGGGGAGG - Intergenic
978543338 4:109842835-109842857 CACAGTGGCAGAGATGATTGTGG + Intronic
978771581 4:112462299-112462321 TACAGAGCCAGATTTGGGTGGGG - Intergenic
981196609 4:141928530-141928552 CCCAGGGCCAGATTTGCTTGTGG - Intergenic
981280001 4:142946306-142946328 CACAGAGTCAGAGTGGGTTGTGG - Intergenic
984566967 4:181342831-181342853 CACAATGACATATTTGGGTGTGG + Intergenic
984588386 4:181588582-181588604 CATAGTCACAGTTTTGGTTAAGG - Intergenic
985131571 4:186743523-186743545 CACAGTGACACAATTAGTTGTGG - Intergenic
985797663 5:1975236-1975258 CACAGTGATGGCTTTGGTGGTGG - Intergenic
986901828 5:12444266-12444288 CACAGTGAAAGATTTTGGTGTGG - Intergenic
997039018 5:130229391-130229413 CAGAATGGCAGATTTGGTTGAGG + Intergenic
999001119 5:147923687-147923709 CACAGTCAAAGATTTGGCAGAGG - Intergenic
999870317 5:155742981-155743003 CATAGTGTAAGGTTTGGTTGGGG + Intergenic
1000140379 5:158397553-158397575 CACAGTCAGAGATTTGCTTCAGG - Intergenic
1000186468 5:158863356-158863378 CAATGTGACAGATGTGGTTCTGG - Intronic
1000500128 5:162037708-162037730 CACAGTCTTAGATTTGGCTGGGG - Intergenic
1001192181 5:169641434-169641456 CACACTGACAGATTTGGCGTGGG + Intronic
1003196897 6:3922621-3922643 CTCTGTGACATATTTGGTTGTGG + Intergenic
1003288235 6:4753745-4753767 CACAGTGATAAATTTCCTTGGGG + Intronic
1003774997 6:9350446-9350468 CACAGTGCCAGATATTGATGAGG + Intergenic
1004569145 6:16828295-16828317 CACAGTGGCAGATTTGAGAGGGG - Intergenic
1005145283 6:22682985-22683007 CAAAGTGACAGGTTGGGGTGGGG + Intergenic
1005224405 6:23624385-23624407 CACAATGACAGATTTGACTAAGG - Intergenic
1010984469 6:82407739-82407761 CAAAGAGACAGATTTGGTTCTGG - Intergenic
1012978953 6:105810100-105810122 CACAGTGACATCTTTGGTCTTGG - Intergenic
1013293131 6:108735981-108736003 CAGAGTTACAGAATTGGTGGGGG - Intergenic
1013917336 6:115356749-115356771 CACAGTGGCAAATTTAGGTGTGG - Intergenic
1014259894 6:119204191-119204213 CACTGTGACAGGTGTGGCTGGGG + Intronic
1014413856 6:121159542-121159564 CAAAGTGACAAAATTGCTTGAGG - Intronic
1019450121 7:1093260-1093282 CACGGTGGCAGATTTGCTTTAGG - Exonic
1019930865 7:4222197-4222219 CACAGTGACAGATGTAGCTTTGG - Intronic
1021407590 7:20290790-20290812 AACAGTGAGAGATCTGCTTGGGG + Intergenic
1021743638 7:23715095-23715117 CAAATTGGCAAATTTGGTTGGGG + Intronic
1025237675 7:57245571-57245593 CACAGAAGCAGTTTTGGTTGCGG - Intergenic
1028032806 7:85938096-85938118 AAAAGAGACAGATTTTGTTGGGG + Intergenic
1028408714 7:90504595-90504617 CAGAGAGCCAGATTTGGTTTGGG + Intronic
1028684958 7:93581795-93581817 CAGAATGATAGATTTGGTTAAGG + Intergenic
1030241247 7:107328126-107328148 CACAATGACAGAATTGCCTGAGG - Intronic
1033190662 7:139275738-139275760 CACAGTGAGAGGATTGCTTGAGG + Intronic
1037575565 8:20198720-20198742 CCCAGTGACAGATCAGGATGTGG - Intronic
1038164169 8:25068621-25068643 CACATTGACAGATTTAATTAAGG - Intergenic
1038309750 8:26437279-26437301 CACAATGACAGGTTTGGCAGGGG + Intronic
1038450889 8:27638063-27638085 CAAAGTGACTGTTTTGGCTGGGG - Intronic
1038528518 8:28297513-28297535 CCCAGTGACAGAGGTGGGTGGGG + Intergenic
1039107301 8:34003519-34003541 CACAGTTCAAGATTTGGTTGGGG + Intergenic
1039351796 8:36771616-36771638 CATAATGACAGATTCGGCTGGGG - Intergenic
1039385779 8:37134358-37134380 CAGTGTGACACATTTGGTTCTGG - Intergenic
1039826939 8:41182771-41182793 CACAGATACAGACTGGGTTGTGG - Intergenic
1041671919 8:60500258-60500280 CAGATTGAGAGATTTGGGTGGGG - Intergenic
1041820623 8:62028420-62028442 CGCAGAGACAGCTTTGATTGAGG - Intergenic
1042281055 8:67056425-67056447 CACAGTGAGAGGATTGCTTGAGG - Intronic
1044327573 8:90877125-90877147 GACAGTGACATATTTGGAAGTGG - Intronic
1044698534 8:94947103-94947125 AAAAGTGACAGAGTTGGTTGGGG + Intronic
1048319487 8:133387329-133387351 CACAATGAAAGATTAGGCTGGGG - Intergenic
1048447859 8:134505398-134505420 GACATGGACAGCTTTGGTTGAGG - Intronic
1048662112 8:136616629-136616651 GACAGGGACAAATTGGGTTGTGG - Intergenic
1051446159 9:17141505-17141527 GAAAGTGACAGATGAGGTTGGGG + Intronic
1051979972 9:23001863-23001885 CAAAATGACAGATTTTCTTGTGG + Intergenic
1052825230 9:33169270-33169292 TAGAGTGACAGATGTGGGTGGGG - Intergenic
1054955345 9:70903339-70903361 ATGAGTGACACATTTGGTTGTGG + Intronic
1056478147 9:86973050-86973072 CACATTGACAGTTTTGCTTAAGG + Intergenic
1056955817 9:91080262-91080284 CTCAGTGCCAGCTATGGTTGAGG - Intergenic
1058171580 9:101687455-101687477 CACAATCATACATTTGGTTGAGG + Intronic
1058719205 9:107748392-107748414 CTCAGTGACAGTCTTGGTTCAGG - Intergenic
1059654973 9:116349289-116349311 CTCAGAGACAGCTTTGGTTTAGG + Intronic
1061890111 9:133614839-133614861 AACAATGGCAGATTTGGATGGGG + Intergenic
1062293643 9:135811387-135811409 CACACTGACAGACATGGTTTTGG + Exonic
1188576456 X:31656646-31656668 AACAGGGACAGATTAGGTTCAGG - Intronic
1189962701 X:46339717-46339739 CTGAGTGACAGCTTTGGTTGTGG + Intergenic
1190909389 X:54757746-54757768 CACAGTGTCAGCTTTGGGCGAGG + Exonic
1191024887 X:55903463-55903485 CAAAGTGGCAGATTTGTTTATGG - Intergenic
1192046701 X:67682914-67682936 AATAGTGACAGAAGTGGTTGAGG - Intronic
1192927742 X:75774358-75774380 CACAGTGATTGATTTGCATGTGG - Intergenic
1194521172 X:94920226-94920248 GACAATGACAGGTTTGGCTGAGG - Intergenic
1197371305 X:125628859-125628881 CACCGTGACAGAGGTGGCTGGGG - Intergenic
1198311395 X:135427853-135427875 TACAGTGACAGATGCCGTTGTGG + Intergenic
1198944580 X:141996234-141996256 CACGGTGACAGATTTCTTTTTGG - Intergenic
1200039039 X:153352862-153352884 CACTGTGCTAGATTTGGTAGGGG - Exonic
1200916058 Y:8572233-8572255 CACAGTCACAGATAGGGGTGAGG + Intergenic