ID: 1068670578

View in Genome Browser
Species Human (GRCh38)
Location 10:59718480-59718502
Sequence TAAATCCACAGTGACAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 183}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068670578_1068670580 19 Left 1068670578 10:59718480-59718502 CCAAATCTGTCACTGTGGATTTA 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1068670580 10:59718522-59718544 TCCAAGTCTACAGAGAGGTATGG No data
1068670578_1068670579 14 Left 1068670578 10:59718480-59718502 CCAAATCTGTCACTGTGGATTTA 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1068670579 10:59718517-59718539 ATGTTTCCAAGTCTACAGAGAGG No data
1068670578_1068670582 26 Left 1068670578 10:59718480-59718502 CCAAATCTGTCACTGTGGATTTA 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1068670582 10:59718529-59718551 CTACAGAGAGGTATGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068670578 Original CRISPR TAAATCCACAGTGACAGATT TGG (reversed) Intronic
902186678 1:14730728-14730750 TTAATTCTCAGGGACAGATTGGG - Intronic
902620651 1:17648799-17648821 TAAATTCTTACTGACAGATTTGG + Intronic
904437827 1:30510573-30510595 TACATGCATAGTGAAAGATTAGG + Intergenic
906456750 1:46003781-46003803 TAAAACCACAGTGACAAGGTTGG + Intronic
907982818 1:59501313-59501335 TAAATCCTCATTGTAAGATTTGG + Intronic
908601629 1:65745428-65745450 TAGAACCACAGGGACAGAATTGG + Intergenic
909693569 1:78438082-78438104 TAATTCCTCAGTGACAGCTCAGG + Intronic
910054260 1:83012533-83012555 TAAAACCACACTGACAGGTAAGG - Intergenic
910663964 1:89704535-89704557 TAAATGCACAGATACAGATCTGG + Intronic
913352620 1:117878543-117878565 AAAATTCACAGTGTGAGATTTGG - Intronic
916378905 1:164187318-164187340 TAAGTCCACAGAGAGAGCTTGGG - Intergenic
916471230 1:165124848-165124870 CAATCCCACAGTGACAGATTTGG + Intergenic
916932548 1:169593892-169593914 TAAATCCACTGCAACAGAATGGG + Intronic
919337342 1:196253501-196253523 TAAATCAACAGAAACAGATTCGG - Intronic
921453704 1:215341234-215341256 TAAATTCACAGTGATATATTTGG + Intergenic
924121461 1:240803573-240803595 TACTTACCCAGTGACAGATTAGG + Intronic
924873909 1:248079678-248079700 AAAGGCCTCAGTGACAGATTAGG - Intronic
924937614 1:248785337-248785359 GAAGTCCACAGTGACAGCTGAGG - Intergenic
1065576184 10:27121237-27121259 CAAATTCACAGAGACAAATTGGG - Intronic
1068100872 10:52551223-52551245 AAAATTCACTGTGAAAGATTAGG + Intergenic
1068670578 10:59718480-59718502 TAAATCCACAGTGACAGATTTGG - Intronic
1069966692 10:72124379-72124401 TAAAGGCACAGTGATATATTTGG - Intronic
1071325160 10:84507818-84507840 TGATTCCACAGTGACCCATTGGG - Intronic
1074258442 10:111827771-111827793 TTCATCCACAGTGACAAGTTAGG + Intergenic
1075373775 10:121961076-121961098 GAAATACACACTGAAAGATTAGG - Intronic
1075632474 10:124009399-124009421 TAAGTCCACAAGGACAGAATAGG + Exonic
1076754197 10:132559528-132559550 TCAATCCACAGAGACAGAAGTGG - Intronic
1078169593 11:8919383-8919405 TGAGCCCACAGTGACAGAATAGG - Exonic
1078413410 11:11146417-11146439 GTAATCCACATTGACAGATGAGG - Intergenic
1078522816 11:12076983-12077005 TAAATACATAATGCCAGATTAGG + Intergenic
1078585150 11:12578996-12579018 CAACTCCACAGCTACAGATTTGG + Intergenic
1080651053 11:34222991-34223013 TAAATACACAGGGTCACATTAGG - Intronic
1081468036 11:43342689-43342711 TAAAACCACAGTGATATTTTTGG + Intronic
1082649781 11:55775554-55775576 TAAAACCACAGTGACTGAGGAGG + Intergenic
1085612087 11:77959770-77959792 TAAATCCACGTTCAGAGATTAGG - Intronic
1086420919 11:86636204-86636226 TAAATCCTCTGTGAGAGCTTAGG + Intronic
1086640390 11:89147633-89147655 AAAGTCCTCAATGACAGATTTGG + Intergenic
1088410996 11:109534482-109534504 CAAATCTACAGGTACAGATTTGG - Intergenic
1088708918 11:112488819-112488841 TTGATCCACAGTTCCAGATTGGG + Intergenic
1089153074 11:116379342-116379364 TAAAGCAGCAGTGAGAGATTTGG - Intergenic
1090711959 11:129395173-129395195 CAAATCCATAATGACAGTTTGGG + Intronic
1093054517 12:14542427-14542449 TAAATGCACAGTTTCAAATTGGG + Intronic
1095128124 12:38506261-38506283 TAAATCCCCAGTGAAATATTTGG + Intergenic
1097509931 12:60526566-60526588 TAAATTAAATGTGACAGATTAGG - Intergenic
1098343428 12:69474678-69474700 TTCATCCAGAGTGTCAGATTTGG + Intronic
1098738062 12:74132662-74132684 TAAACAGACAGTGACAGAATGGG - Intergenic
1099461129 12:82922716-82922738 TAAATACACAGTGATATTTTGGG + Intronic
1101848317 12:108381768-108381790 GAAATGCTCAGTGACACATTAGG + Intergenic
1107187339 13:37539061-37539083 CACATCTACAGTGACAGATGAGG + Intergenic
1109623718 13:64945657-64945679 TAATTCCACACTCCCAGATTGGG + Intergenic
1111029122 13:82572975-82572997 TCAACCCACAAAGACAGATTTGG + Intergenic
1111946458 13:94670397-94670419 TACATGTACAGTGACAGACTGGG + Intergenic
1112567409 13:100563272-100563294 TAAAGCCACAGTGACAGGTAGGG + Intronic
1112572626 13:100607635-100607657 AAAATGCACAGTCACAGATATGG - Intronic
1113868686 13:113545243-113545265 CAAATCCACATTCACAGATGAGG + Intronic
1115364078 14:32536516-32536538 TAAATCCATATTAAGAGATTTGG + Intronic
1115521419 14:34236447-34236469 GAAATCCACTGAGACAGCTTAGG + Intronic
1117294079 14:54362936-54362958 TAAATACACAGTGACAGGGAAGG + Intergenic
1117620302 14:57579222-57579244 TAAGGTCACAGTGACAGATTTGG + Intronic
1117937791 14:60926699-60926721 AAAATCCAAAATGACAGAGTTGG - Intronic
1119820624 14:77613130-77613152 TAAATCCACAGGAAGAAATTTGG + Intronic
1120177883 14:81314574-81314596 TCAATCCAAAGTGACAGTTAAGG + Intronic
1121563151 14:94888931-94888953 TGAAAACACAGTGACAGATGTGG - Intergenic
1129646075 15:77434650-77434672 TAAAGCCACAGTGAGATACTTGG + Intronic
1131412827 15:92225034-92225056 TAAATACACAGTGACTCATATGG + Intergenic
1135877081 16:26212680-26212702 ACAATGCACAGTGACAGACTTGG - Intergenic
1138374826 16:56555743-56555765 AACATCCACAGTGAGCGATTTGG + Intergenic
1142820705 17:2464604-2464626 TAAAGAAAAAGTGACAGATTGGG - Intronic
1144251882 17:13425558-13425580 TAGAACCACAGTGACAGAGCAGG - Intergenic
1148976989 17:51538318-51538340 GAACTCCACAGTGAAAGCTTAGG + Intergenic
1151123698 17:71821789-71821811 TAAAACCACACTGATTGATTTGG + Intergenic
1153452283 18:5242988-5243010 TAATTCTACAGAAACAGATTAGG + Intergenic
1153581037 18:6573492-6573514 AAAAACCACAGTGAGACATTGGG + Intronic
1154503292 18:15007133-15007155 TAAATCCACAGTGGAACCTTGGG - Intergenic
1155339835 18:24802800-24802822 TAAACCCACACTGACTGACTGGG + Intergenic
1155559827 18:27063711-27063733 TAAAATCAAACTGACAGATTGGG - Intronic
1157579327 18:48764368-48764390 TGAATCCACAGTGACAAACTGGG + Intronic
1158027941 18:52924936-52924958 CAAATCCAAAATGAGAGATTTGG + Intronic
1158233120 18:55280892-55280914 TAGGTCCACAGAGACAGATGTGG + Intronic
1159095351 18:63895442-63895464 TAAAGCCACAGTGTCAGACTGGG + Intronic
1160763009 19:795271-795293 CAAATCCACAGTAACACACTGGG + Intergenic
1167013034 19:46821593-46821615 TCAATCCACAGTGGCGGTTTGGG - Intergenic
926033502 2:9614225-9614247 TTAATGCAGATTGACAGATTTGG - Intronic
929085746 2:38165635-38165657 TAAATCCACAATAAAAGACTAGG - Intergenic
930555975 2:52896092-52896114 TGTCTCCTCAGTGACAGATTTGG + Intergenic
931076044 2:58713529-58713551 TATATCTACAGTAACAGAATGGG - Intergenic
932146677 2:69326189-69326211 TCACTCTACAGTCACAGATTTGG + Exonic
933334611 2:80941446-80941468 TAAATCATCAAAGACAGATTAGG + Intergenic
933544079 2:83687340-83687362 TAAATTAACAGAGACAGATTTGG + Intergenic
939681910 2:145146749-145146771 TAAATCCACAGGGAGAGGTTGGG - Intergenic
941592676 2:167439378-167439400 TAAATACAAAATGACATATTAGG - Intergenic
942124187 2:172806740-172806762 TAATTTCACAGTGATAGATGAGG - Intronic
942343890 2:174981015-174981037 TATATCCACAGTGCAAAATTTGG - Intronic
942484132 2:176421749-176421771 GAAATTCAGAGTGCCAGATTTGG + Intergenic
943203927 2:184865595-184865617 AAAATCCACAGTCAAACATTTGG + Intronic
943228396 2:185210588-185210610 TCAATACAGAGTGGCAGATTGGG - Intergenic
943420754 2:187665932-187665954 TAAATCCACATTGAAAAATAAGG + Intergenic
945541543 2:211093357-211093379 TTAATTCACAGAAACAGATTTGG - Intergenic
947447851 2:230178227-230178249 AAAATCCACAGTGTCACTTTTGG + Exonic
948913166 2:241016170-241016192 AAAATCCACCATGACAGAGTGGG - Intronic
1170182578 20:13548791-13548813 TAAGCCCACTGTGACATATTAGG + Intronic
1177697198 21:24588769-24588791 TAAATCCACAGAAACAAATGGGG - Intergenic
1179634876 21:42702449-42702471 TCAATCAACAGAGACAGACTCGG - Intronic
1182189846 22:28447486-28447508 TAAATCAGCAGTCACAAATTAGG - Intronic
1183556526 22:38531982-38532004 TAACTCTAGAGTGACAGTTTTGG + Intronic
1183772388 22:39938271-39938293 ATAATCCACAGTGACAGACAGGG + Intronic
1185250336 22:49798506-49798528 CAAATCCACAGTCACACATGCGG + Intronic
950070697 3:10149748-10149770 CAAATCCTCAGTGGCAGACTAGG - Intronic
950655160 3:14432041-14432063 CAGAGCCACAGTGACAGAGTTGG + Intronic
951739294 3:25902485-25902507 TAAATGCACAGTGACATTTCAGG + Intergenic
953193941 3:40714488-40714510 TAAACCCACAGTGTGAGATCGGG - Intergenic
956056751 3:65307121-65307143 TGAGTCAACAATGACAGATTAGG + Intergenic
959266990 3:104154911-104154933 TAAATCCACATTTATAGTTTTGG + Intergenic
962275417 3:134009890-134009912 ACATTCCACAGTGACAGATCTGG - Intronic
962762824 3:138532391-138532413 GAACTTCACAGTGACATATTAGG + Intronic
962851547 3:139311976-139311998 TAAATGCACAGTGAAAAAGTAGG - Intronic
963510467 3:146241557-146241579 GAAATCCACAGTTACAGTTGAGG + Intronic
964043284 3:152290869-152290891 TAGTTCTACATTGACAGATTCGG + Intronic
965181538 3:165410339-165410361 TAAGCCCACAGGGATAGATTTGG - Intergenic
966491350 3:180531587-180531609 CAGATCCACAGTGGCAGTTTGGG - Intergenic
966984691 3:185168402-185168424 TAAACCCACAGTATCAGCTTGGG + Intergenic
967092471 3:186146798-186146820 CACATACTCAGTGACAGATTAGG - Intronic
967688770 3:192448941-192448963 TAAATGTACAGTGCCAGAGTTGG - Intronic
969172610 4:5376241-5376263 TAAATCCACAGGGACAAAGGAGG - Intronic
972045336 4:34658270-34658292 TAAATGCACAGTGTCAGTATAGG + Intergenic
974848347 4:67378722-67378744 CTAATCCACAGTGACAGATCAGG - Intergenic
977188946 4:93976242-93976264 TAAAGTCACATTCACAGATTCGG + Intergenic
979208015 4:118064747-118064769 GAAATGCAAAATGACAGATTTGG - Intronic
979918275 4:126467410-126467432 TAAATCCTCAGTCTCAAATTAGG - Intergenic
982979732 4:162117240-162117262 TAAATCCCCTCTGACAGATGGGG - Intronic
984439394 4:179747208-179747230 TAAATCAACACTGTAAGATTGGG - Intergenic
985002461 4:185499706-185499728 TAAATTAACAATGAAAGATTTGG - Intergenic
985959600 5:3290742-3290764 GAAATCCACACTGAGAAATTAGG + Intergenic
988110108 5:26808314-26808336 TAAAATCACAGTGTCAGCTTTGG - Intergenic
989573314 5:42965747-42965769 GAAATCCAAAGAGACATATTTGG + Intergenic
989580266 5:43025995-43026017 GAAATCCAAAGAGACATATTTGG + Intergenic
993651346 5:90526510-90526532 TAATTCCACATTCACAGTTTTGG + Intronic
995296154 5:110524784-110524806 TAAATCAATATTGACAGAATTGG - Intronic
995669072 5:114579754-114579776 TATAACCAGAGTGACAGATAGGG + Intergenic
996424184 5:123294698-123294720 TAAAGCCACAGTGACAGGAAGGG + Intergenic
998279259 5:140788985-140789007 TAAAATAACAGTGACATATTCGG + Intronic
998446628 5:142203895-142203917 TACATACATAGAGACAGATTTGG + Intergenic
999146120 5:149396156-149396178 TCAAACCATACTGACAGATTTGG - Intronic
1000306490 5:159999554-159999576 CAAATCCACACTGTCAGATAAGG - Intergenic
1001192178 5:169641428-169641450 TCCATGCACACTGACAGATTTGG + Intronic
1002592632 5:180301564-180301586 TCATTCCACAGTTACAGACTTGG + Exonic
1003193221 6:3892269-3892291 TTATTCCCCAGTGAAAGATTAGG - Intergenic
1003244681 6:4374021-4374043 TAAACCCCCAGTGCCACATTTGG + Intergenic
1004696928 6:18042716-18042738 TGAATCCACAGCTACAGTTTGGG - Intergenic
1004903027 6:20211337-20211359 TAAATCAACATTTACTGATTGGG + Intronic
1008562897 6:52739364-52739386 TAAATCCAAAGTGACATTCTAGG + Intergenic
1010053701 6:71538868-71538890 TAAAACCACAATGAGATATTAGG + Intergenic
1011894934 6:92214231-92214253 TAAGTCCATAATGACAGGTTTGG + Intergenic
1012822182 6:104099566-104099588 TACATCAACTGTGACAGAATTGG - Intergenic
1014360765 6:120471176-120471198 TAAAACCAAGCTGACAGATTTGG + Intergenic
1014628341 6:123758092-123758114 TAAATCCACACTGCCAAACTCGG + Intergenic
1018116548 6:160591395-160591417 TTAATCCAAAGTAACATATTTGG - Intronic
1019473247 7:1232321-1232343 TAAATTCAATGTGACAGTTTCGG + Intergenic
1021101565 7:16590329-16590351 TCAAACCATAATGACAGATTTGG - Intergenic
1021743211 7:23709947-23709969 TAAATCCACGTGAACAGATTAGG + Intergenic
1022566401 7:31407038-31407060 TACATCCACAAAGACAGGTTGGG - Intergenic
1025027456 7:55528973-55528995 TAAATTCACAGTGTTATATTTGG + Intronic
1025605456 7:63037275-63037297 GCAATGCACAGTCACAGATTGGG - Intergenic
1026413109 7:70147342-70147364 AAAATCCACAGTTATAGATGAGG + Intronic
1026994429 7:74606409-74606431 TAAATCCAGAGTCACAGGATCGG - Intergenic
1028009158 7:85618751-85618773 CAAATCCACAGTTATAGATGGGG - Intergenic
1029337092 7:99910792-99910814 TCAATCAACATTGACAAATTGGG + Intronic
1030257901 7:107531440-107531462 TAAATACAAAATGACAGAATTGG - Intronic
1030908204 7:115212669-115212691 TAAATGCACAGTGGGAGAATGGG + Intergenic
1030939174 7:115623866-115623888 TAACTCCTGAGTGACAGTTTTGG + Intergenic
1038979047 8:32736656-32736678 TCATTCCACAGTGAAATATTTGG - Intronic
1041558325 8:59184663-59184685 GACAGCCACAGTGACAGAATAGG - Intergenic
1041977147 8:63812927-63812949 TAAATCCCCATAGACAGATTTGG - Intergenic
1043293145 8:78628974-78628996 TATTTCCACAGTCACAGACTTGG + Intergenic
1043800772 8:84607026-84607048 TAAATCTAAAGTGCCACATTCGG + Intronic
1044216201 8:89613653-89613675 TAAATTCAGAATGATAGATTAGG + Intergenic
1044520497 8:93193808-93193830 TATATAAACAGGGACAGATTTGG + Intergenic
1045757273 8:105558613-105558635 TAAATCCACAGGTATAGATAAGG + Intronic
1046450184 8:114379919-114379941 AAAATCCACAGTGACAAAGCAGG - Intergenic
1047960769 8:130010185-130010207 TAAATCCACAGTGAAAAAGAAGG - Intronic
1048394977 8:134005731-134005753 GGAATCCACAGAGACAGCTTAGG - Intergenic
1048414461 8:134210853-134210875 TAATTCCTCAATTACAGATTTGG + Intergenic
1048682696 8:136862952-136862974 TAATTGCTCAGTAACAGATTAGG - Intergenic
1053592536 9:39528685-39528707 TAAATCCACACTATCAGATTGGG - Intergenic
1053850329 9:42283713-42283735 TAAATCCACACTATCAGATTGGG - Intergenic
1054573766 9:66836595-66836617 TAAATCCACACTATCAGATTGGG + Intergenic
1054946294 9:70799471-70799493 TAAATCCTCAGTGAGAAATATGG + Intronic
1057306246 9:93913778-93913800 AAACTCCCCAGTGAGAGATTGGG + Intergenic
1058570976 9:106343518-106343540 TAAATCCACAATTATAGATGGGG + Intergenic
1060274335 9:122171042-122171064 TATATCCAAAATGACAGATGGGG + Intronic
1185554581 X:1010408-1010430 AAAATCCAAGATGACAGATTTGG - Intergenic
1185830688 X:3300136-3300158 AAAATCAACAGTGACAGTTATGG + Intergenic
1190091049 X:47437763-47437785 TAAATGCACAGTGAAAGGTCTGG - Intergenic
1190134079 X:47778596-47778618 AAAGTCCTCAGTGACAAATTTGG - Intergenic
1192192800 X:69002946-69002968 TAAAACACAAGTGACAGATTGGG - Intergenic
1195867061 X:109444152-109444174 TTCAGCCACAGTGACAGTTTTGG + Intronic
1195887205 X:109651654-109651676 TAAATTCTCAGCTACAGATTTGG + Intronic
1196477564 X:116106659-116106681 TAAAACCACAGTGATATTTTTGG - Intergenic
1199657617 X:150012563-150012585 TATCTCCAAAGTGACAGATGAGG + Intergenic