ID: 1068670578

View in Genome Browser
Species Human (GRCh38)
Location 10:59718480-59718502
Sequence TAAATCCACAGTGACAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068670578_1068670580 19 Left 1068670578 10:59718480-59718502 CCAAATCTGTCACTGTGGATTTA No data
Right 1068670580 10:59718522-59718544 TCCAAGTCTACAGAGAGGTATGG No data
1068670578_1068670579 14 Left 1068670578 10:59718480-59718502 CCAAATCTGTCACTGTGGATTTA No data
Right 1068670579 10:59718517-59718539 ATGTTTCCAAGTCTACAGAGAGG No data
1068670578_1068670582 26 Left 1068670578 10:59718480-59718502 CCAAATCTGTCACTGTGGATTTA No data
Right 1068670582 10:59718529-59718551 CTACAGAGAGGTATGGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068670578 Original CRISPR TAAATCCACAGTGACAGATT TGG (reversed) Intronic