ID: 1068670580

View in Genome Browser
Species Human (GRCh38)
Location 10:59718522-59718544
Sequence TCCAAGTCTACAGAGAGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068670576_1068670580 25 Left 1068670576 10:59718474-59718496 CCTCAACCAAATCTGTCACTGTG 0: 1
1: 0
2: 0
3: 24
4: 200
Right 1068670580 10:59718522-59718544 TCCAAGTCTACAGAGAGGTATGG No data
1068670578_1068670580 19 Left 1068670578 10:59718480-59718502 CCAAATCTGTCACTGTGGATTTA 0: 1
1: 0
2: 0
3: 15
4: 183
Right 1068670580 10:59718522-59718544 TCCAAGTCTACAGAGAGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068670580 Original CRISPR TCCAAGTCTACAGAGAGGTA TGG Intronic
No off target data available for this crispr