ID: 1068671789

View in Genome Browser
Species Human (GRCh38)
Location 10:59730512-59730534
Sequence CTGTGGACCACTACAGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 2, 1: 72, 2: 45, 3: 26, 4: 184}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068671789_1068671796 17 Left 1068671789 10:59730512-59730534 CCTTGCTCTGTAGTGGTCCACAG 0: 2
1: 72
2: 45
3: 26
4: 184
Right 1068671796 10:59730552-59730574 GGCATGAAAGTTCTACATCGGGG No data
1068671789_1068671797 18 Left 1068671789 10:59730512-59730534 CCTTGCTCTGTAGTGGTCCACAG 0: 2
1: 72
2: 45
3: 26
4: 184
Right 1068671797 10:59730553-59730575 GCATGAAAGTTCTACATCGGGGG No data
1068671789_1068671794 15 Left 1068671789 10:59730512-59730534 CCTTGCTCTGTAGTGGTCCACAG 0: 2
1: 72
2: 45
3: 26
4: 184
Right 1068671794 10:59730550-59730572 ATGGCATGAAAGTTCTACATCGG No data
1068671789_1068671795 16 Left 1068671789 10:59730512-59730534 CCTTGCTCTGTAGTGGTCCACAG 0: 2
1: 72
2: 45
3: 26
4: 184
Right 1068671795 10:59730551-59730573 TGGCATGAAAGTTCTACATCGGG No data
1068671789_1068671792 -4 Left 1068671789 10:59730512-59730534 CCTTGCTCTGTAGTGGTCCACAG 0: 2
1: 72
2: 45
3: 26
4: 184
Right 1068671792 10:59730531-59730553 ACAGAACGTTGGACCAACTATGG No data
1068671789_1068671798 19 Left 1068671789 10:59730512-59730534 CCTTGCTCTGTAGTGGTCCACAG 0: 2
1: 72
2: 45
3: 26
4: 184
Right 1068671798 10:59730554-59730576 CATGAAAGTTCTACATCGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068671789 Original CRISPR CTGTGGACCACTACAGAGCA AGG (reversed) Intronic
900765692 1:4503677-4503699 CTGGGTACCACTACAGACAATGG - Intergenic
901358842 1:8677624-8677646 CAGTGGAGCCCTACAGAGAAGGG - Intronic
901946330 1:12706982-12707004 CTGTGGACCACTAAAGAGCAAGG - Intergenic
902051990 1:13571028-13571050 CTGTGGACCACTAAAGAGCAAGG + Intergenic
902162505 1:14542694-14542716 CTGTGGACTAGTAGAGAGTAGGG - Intergenic
904532411 1:31177947-31177969 CTGTGGACCACTCCTGACCATGG - Intergenic
904712953 1:32444753-32444775 CTGTGGACCACTAAAGAGCAAGG - Intergenic
904899248 1:33843617-33843639 CTGTGGACTGCTAGAGAGCAAGG + Intronic
905061145 1:35140137-35140159 CTGTGGACCACTAAAGGGCAAGG - Intergenic
905162533 1:36049185-36049207 CTGTGGACTACTAGAGAGGAGGG + Intronic
906423814 1:45692188-45692210 CTGTGGAGAACTATAAAGCAGGG + Intronic
906848149 1:49217005-49217027 CTGTTGACAACTAGAGAGCCAGG + Intronic
908208543 1:61876234-61876256 CTGTGGGTCAAAACAGAGCATGG + Intronic
908438862 1:64133375-64133397 CTAGGAACCACTGCAGAGCAAGG - Intronic
908554149 1:65240285-65240307 CTGGGGACTACTAGAGGGCAAGG - Intergenic
910808069 1:91208370-91208392 CTGTGGACCACTAAAGAGCAAGG - Intergenic
910852950 1:91666491-91666513 CTGTTGACCACTAAAGAGCAAGG - Intergenic
912170809 1:107097193-107097215 CTGTGGACCACTAGAGGGTTGGG - Intergenic
912816031 1:112829359-112829381 CTGTGGACCACTAAACAGCAAGG + Intergenic
912980408 1:114365997-114366019 CTGTGGACCACTAAAAAGCAAGG - Intergenic
913084512 1:115424392-115424414 CTGTGGTCCCCACCAGAGCACGG - Intergenic
917960832 1:180143075-180143097 CTGTAAACTACTAGAGAGCAAGG + Intergenic
918008035 1:180560328-180560350 CTGTGTATCTCTTCAGAGCAAGG + Intergenic
918084929 1:181237309-181237331 CAGTGGAACAGAACAGAGCAGGG + Intergenic
920304947 1:205012724-205012746 CAGTGGAGCCCTAGAGAGCAGGG + Intronic
920865323 1:209747701-209747723 CCGTGGACCACAAAAGAGCAAGG + Intergenic
921074648 1:211690538-211690560 CTGTGGACCACTACAGAACAAGG + Intergenic
921538018 1:216376250-216376272 CTGTGAAGCACAACAGAACAAGG + Intronic
922680760 1:227593422-227593444 CTGTGGACCACTAAAGGGCAAGG - Intronic
922690163 1:227682682-227682704 CTGTGGACGACTAAAGAGCAAGG + Intergenic
924859062 1:247902366-247902388 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1064240752 10:13626160-13626182 CTGAGATCCACCACAGAGCAAGG + Intronic
1064756519 10:18576452-18576474 CTGTGGACCACTAAAGAGCAAGG + Intronic
1065382118 10:25101245-25101267 CTGTGCACCACTGCAGAGGTAGG + Intergenic
1065492178 10:26293114-26293136 CTGTGGACTCCTACAGAGCCAGG + Intronic
1065931014 10:30479149-30479171 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1068671789 10:59730512-59730534 CTGTGGACCACTACAGAGCAAGG - Intronic
1068675788 10:59767989-59768011 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1069242962 10:66165287-66165309 CTGGGGACCACTAGAGTGAAGGG + Intronic
1069828819 10:71270476-71270498 CTGTACACCACTAGAGGGCAGGG + Intronic
1069939254 10:71943160-71943182 CTGTGGATCACTAAAGAGCAAGG + Intergenic
1070789120 10:79179269-79179291 CTGTGGACTCCTAGAGAACAGGG + Intronic
1070848682 10:79545037-79545059 CTGTGCTCCACTGCAGAGCAGGG + Intergenic
1070925100 10:80215153-80215175 CTGTGTTCCACTGCAGAGCAGGG - Intergenic
1070983207 10:80666698-80666720 CTTTGCCCCACTACAGAGCTGGG + Intergenic
1072334808 10:94388553-94388575 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1073991613 10:109268138-109268160 ATATGGACCACACCAGAGCAGGG - Intergenic
1074570621 10:114620892-114620914 CTGGGGCAAACTACAGAGCATGG - Intronic
1075065874 10:119288554-119288576 ATGTGGTCCACTCCAGGGCAGGG - Intronic
1075384402 10:122044787-122044809 CTCTGGAACACTCCAGAGCCTGG - Intronic
1079052188 11:17171615-17171637 CTGTGGTAGACTACAAAGCATGG + Intronic
1079423923 11:20322335-20322357 CTGTGGTCCTCTAGAGAGGACGG + Intergenic
1081510191 11:43763062-43763084 CTATGCAGCACTACTGAGCAAGG - Intronic
1081849633 11:46265983-46266005 CTGAGGACCAGTGCAGGGCAGGG + Intergenic
1082826855 11:57586314-57586336 CTGTGAACCACAGAAGAGCAGGG - Intergenic
1083089899 11:60189137-60189159 CTGTTGACCACTAAAGAGCAAGG + Intergenic
1083487924 11:62995342-62995364 CTCTGGAACCCCACAGAGCAAGG - Intronic
1084150500 11:67285885-67285907 CTGTGGAGCAGGACAGTGCAGGG - Exonic
1084662651 11:70555632-70555654 CAGTGGATCACTTCAGTGCAGGG + Intronic
1085239789 11:75043760-75043782 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1085400046 11:76230468-76230490 CTGGGGACCCCCAGAGAGCAGGG - Intergenic
1085534281 11:77208741-77208763 CTGTGGACCACCACGGTGCCAGG + Exonic
1085635661 11:78157679-78157701 CAGTAGACCACTGCAGAGGAGGG + Intergenic
1086973455 11:93107552-93107574 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1087456796 11:98396743-98396765 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1087684522 11:101248246-101248268 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1087894816 11:103575742-103575764 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1088571834 11:111230326-111230348 CTGTGGATCACTACATAGCATGG - Intergenic
1088706494 11:112468703-112468725 CTGTGCACCACTCAAGGGCAGGG - Intergenic
1089305248 11:117522350-117522372 CTGTGGGCCACTTGAGAGCAGGG + Intronic
1089731485 11:120522135-120522157 CTTAGGATCACTCCAGAGCATGG - Intronic
1090357795 11:126151540-126151562 CTGCTGTCCACTTCAGAGCAGGG + Intergenic
1091027834 11:132157976-132157998 CTGTGGAACACTCCAGACAAAGG - Intronic
1091814510 12:3426388-3426410 CTGTGGACCACTAAAGAGCAAGG - Intronic
1093297653 12:17410791-17410813 CTCAGGACCACCACAGAGGAAGG - Intergenic
1093356752 12:18176374-18176396 CTATGGACCACTAAAGAGCAAGG + Intronic
1095162346 12:38933141-38933163 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1096122178 12:49095191-49095213 CTGGGGAGGACTACAGAGAAGGG - Intergenic
1096207725 12:49737472-49737494 CTATGGACCACTAAAGAGCAAGG + Intronic
1097034394 12:56113212-56113234 TTGTGCCCCACTACAGAACAGGG + Exonic
1097871872 12:64609158-64609180 CTGTAGTCCACAAAAGAGCACGG + Intergenic
1098248400 12:68543918-68543940 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1098955094 12:76681400-76681422 GTGTGGACCACTCCACAGGATGG - Intergenic
1099993831 12:89755057-89755079 CTGAGGACCACTAGAGAGGGAGG - Intergenic
1100021604 12:90075726-90075748 CTGTGGACCACTAACTATCAAGG + Intergenic
1100169204 12:91954344-91954366 CTGTGAAGCACAATAGAGCAAGG - Intergenic
1100922627 12:99505700-99505722 CTGTGAACTTCTTCAGAGCAAGG - Intronic
1101796541 12:107980142-107980164 CTGTGGGTCACTTCAGCGCAGGG - Intergenic
1102168585 12:110824944-110824966 CTTTGGGCCACTGCAAAGCAGGG + Intergenic
1102606390 12:114070975-114070997 CTGTGGATCACCAAACAGCAAGG + Intergenic
1103924501 12:124416117-124416139 CTGTGGCTCACTGCAGAGCTTGG - Intronic
1105569475 13:21588101-21588123 CTGCGGACCACTAAAGAGCAAGG + Intronic
1105595166 13:21830632-21830654 CTGGGGACTACTAGAGAGGAGGG - Intergenic
1107827795 13:44345250-44345272 CTGTGGAATACTACCCAGCAAGG - Intergenic
1108768842 13:53670557-53670579 CTGTGGAATACTACAGAGAAAGG + Intergenic
1109104823 13:58237878-58237900 CTGGAGACTACTACAGAGAAGGG - Intergenic
1109652875 13:65352891-65352913 CTGGGGACCAGTCCAGAGCCTGG - Intergenic
1110587208 13:77207795-77207817 CTGTTGAACACTAAAGACCAAGG - Intronic
1110653702 13:77972465-77972487 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1111578260 13:90187899-90187921 CAGTGGAACACCACAGTGCATGG + Intergenic
1112424815 13:99288327-99288349 CTGAAAACCACTCCAGAGCAGGG - Intronic
1113146319 13:107211986-107212008 CTTTGGAGCCCTACAGAACATGG - Intronic
1113861432 13:113490247-113490269 CTGTTGACCAAAACAGCGCAAGG - Intronic
1114223495 14:20717745-20717767 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1114236080 14:20824879-20824901 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1115211372 14:30970365-30970387 CTGTGGACCACTAAAGAGCAAGG + Intronic
1116237333 14:42296431-42296453 CTGTGGACTACTATAGAGGATGG + Intergenic
1116265286 14:42680660-42680682 CTGTGGACTACTAGAGCGTAAGG + Intergenic
1116751603 14:48892736-48892758 CTGTGGAGCACTAAACAGGAAGG + Intergenic
1117179536 14:53177918-53177940 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1117898335 14:60509724-60509746 CTGTGGACAAGTACCGAGTAAGG + Exonic
1117955190 14:61117403-61117425 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1118206782 14:63729854-63729876 CTGTGAACAACTTGAGAGCATGG - Intergenic
1120090190 14:80322785-80322807 CTGCTGACCACTACACTGCATGG + Intronic
1122010944 14:98746436-98746458 TTGTGGACCTCCAAAGAGCAAGG - Intergenic
1124217450 15:27819371-27819393 CAGGGGACAACTTCAGAGCAGGG + Intronic
1125288258 15:38117877-38117899 CTGTGGCACAGTACATAGCAAGG + Intergenic
1125690330 15:41591043-41591065 CTGTGAACCACCAAAGAGCAAGG + Intergenic
1125764142 15:42121844-42121866 CTGTGGACCCCTCCAGGGCCAGG - Intergenic
1128699115 15:69791093-69791115 CTGTGTACCACTGCAGGGCAGGG - Intergenic
1129656983 15:77530830-77530852 CTGTGGAATGCAACAGAGCAGGG - Intergenic
1130239368 15:82171704-82171726 CTGTGGACTACTAGAGAGTGGGG + Intronic
1135971105 16:27072618-27072640 CTGTGGAACACCACACAGCCAGG - Intergenic
1136508804 16:30723338-30723360 CTGGGGCCCACTACAAATCAAGG - Intronic
1137041598 16:35617649-35617671 CTGTGAACCACTAAAGAGCAAGG - Intergenic
1137767182 16:50987071-50987093 CTGAGGCCCAATACTGAGCAAGG + Intergenic
1140573426 16:76135697-76135719 CAGTGGACCACTTCAGAGGATGG + Intergenic
1140944742 16:79757430-79757452 CAGTGGGTCACTACCGAGCAGGG + Intergenic
1141353675 16:83323015-83323037 CTGTGGCCCCCTACAGGGTAGGG - Intronic
1142475641 17:187463-187485 CTGGGGACCACTAGAGCCCAGGG + Intergenic
1143464837 17:7129656-7129678 CTGTGGAGAAAAACAGAGCAAGG - Intergenic
1145242902 17:21250037-21250059 GTGGGGACCAGGACAGAGCAGGG - Intronic
1145853441 17:28127253-28127275 CTCTGGAGCACTCCAGAGCTAGG - Intronic
1145943758 17:28758465-28758487 CCGGGGCCCACTACCGAGCAGGG - Exonic
1146569389 17:33939748-33939770 CTGTTGCCCACGGCAGAGCAGGG + Intronic
1146764167 17:35504317-35504339 CTGTGGACCACTAAAGAGCAAGG + Intronic
1147950276 17:44103682-44103704 CTGTGGACCACTTCTCAGAATGG + Intronic
1148828958 17:50416751-50416773 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1149019530 17:51947153-51947175 CTGAGGGCCTCTAAAGAGCAAGG - Intronic
1149498591 17:57134633-57134655 CTGTGGGCCCCTCCAGAGCAGGG + Intergenic
1151304607 17:73255170-73255192 CACTGGGCCTCTACAGAGCAAGG + Intronic
1152691964 17:81722418-81722440 CAGTGGGCCACCACAGGGCAGGG + Intergenic
1153826372 18:8878735-8878757 CTGTGGGCCACTAAAGAGCAAGG - Intergenic
1153830391 18:8917357-8917379 CTGTGGACTGCTAAAGAGCAAGG + Intergenic
1154014126 18:10601439-10601461 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1154463245 18:14617657-14617679 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1155746193 18:29358593-29358615 CTGTGAACCACTAAAGAGCAAGG - Intergenic
1160420873 18:78742957-78742979 CTAAGGACCACCTCAGAGCAGGG - Intergenic
1161511501 19:4674835-4674857 CTGAGGACCACGACAGGCCAAGG - Intergenic
1162267802 19:9590130-9590152 CTGTGGACCACCAAAGAGCAAGG - Intergenic
1162281905 19:9705494-9705516 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1163991856 19:21006336-21006358 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1164121562 19:22269896-22269918 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1164216952 19:23158918-23158940 CTTTGGACCACTAAAGAGCAAGG - Intergenic
1166286959 19:41837042-41837064 CTGTGGTCCATGAGAGAGCAGGG - Intergenic
1168050185 19:53824059-53824081 CTGGGGACCGCGACAGAGCTGGG - Exonic
925007726 2:457266-457288 CTGTGGAGCAGTCCAGAGGAGGG + Intergenic
926491447 2:13530004-13530026 CTGTGGACCACTAAAGAGCAAGG - Intergenic
926599552 2:14827167-14827189 ATTTGAACCACCACAGAGCAAGG + Intergenic
927511185 2:23644731-23644753 CTCAGGACCACCACAGAGGATGG - Intronic
929295492 2:40241637-40241659 CTGAAGACCACAACAGAGTAGGG + Intronic
930093516 2:47548927-47548949 CTGTGGAGCACTGGAGAGGAAGG + Intronic
930171079 2:48252456-48252478 CTATGGAGAACAACAGAGCAAGG + Intergenic
933299912 2:80530065-80530087 CTGTGGTCCACTACTGACCATGG + Intronic
934298170 2:91759798-91759820 CTATGGACGACACCAGAGCAGGG - Intergenic
935721482 2:105983146-105983168 CTGTGGACCACTAAAGAGCAAGG - Intergenic
935970593 2:108527416-108527438 CTGTGGACCAGTAAAGAGCAAGG + Intergenic
936419589 2:112350474-112350496 CTGTGGACCAGTAAAGAGCAAGG - Intergenic
938703170 2:133897467-133897489 CTGTGGACCACTAAAGAGCAAGG + Intergenic
938926125 2:136044112-136044134 CTGGGGACTACCACAGAGTAGGG + Intergenic
939955974 2:148527957-148527979 CTGTGGATCAGGAAAGAGCAGGG - Intergenic
940352835 2:152707840-152707862 CTGTAGACCACTAAAGAGCACGG + Intronic
940549723 2:155138709-155138731 CTGTTGACTATTACAGAGGAGGG + Intergenic
943408098 2:187514079-187514101 CCGTGGACCACTACAGAGCAAGG + Intronic
943701305 2:190990751-190990773 CTGTGGACCACCACAGTAAATGG - Intronic
945068294 2:205965793-205965815 CTGTGGAGCCCTGCAGGGCAGGG - Intergenic
945289744 2:208115494-208115516 CTGTGGACCACTAAAGAGCAAGG + Intergenic
945916564 2:215710720-215710742 CTGTGGAGCAATGCAGATCAGGG - Intergenic
947232764 2:227904561-227904583 CTTGGAAACACTACAGAGCAGGG - Intronic
948813900 2:240499923-240499945 CTGTGGAGCAGAGCAGAGCAGGG + Intronic
948934481 2:241153713-241153735 CTGAGGACCCCTAAGGAGCACGG - Intronic
1168824207 20:798379-798401 CTGTGGACCATTAAAGAGCAAGG + Intergenic
1175513868 20:59555616-59555638 CTGTAGACCACTAAAGAGCAAGG - Intergenic
1176381716 21:6117112-6117134 CTGTGGTCCTCAACAGAGCCTGG + Exonic
1176811278 21:13540716-13540738 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1177044872 21:16156946-16156968 TTATGGACCACTATGGAGCATGG - Intergenic
1177206173 21:18014463-18014485 CTATGGACTACTACACAGAAGGG + Intronic
1179670876 21:42946794-42946816 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1179741756 21:43421127-43421149 CTGTGGTCCTCAACAGAGCCTGG - Exonic
1180059633 21:45378092-45378114 CCGTGGACCCCTCCAGAGCCTGG - Intergenic
1184048478 22:41987385-41987407 CTGTCGGGAACTACAGAGCATGG - Intronic
1184433784 22:44457831-44457853 CTGTGATCCCTTACAGAGCACGG - Intergenic
949610940 3:5702794-5702816 CTGTGGACCACTAAAGAGCAAGG - Intergenic
950594284 3:13965196-13965218 CTGTGGACCACTAAAGAGCAAGG - Intronic
950846133 3:16017719-16017741 CTGTGGACCACTGAAGAGTGAGG - Intergenic
951248544 3:20368019-20368041 CTGTGGACCACTACAGAGCAAGG - Intergenic
952219820 3:31313751-31313773 CTGTGGACCACAAGAGAGAATGG - Intergenic
954420507 3:50416578-50416600 CTGGGGCCCAGGACAGAGCAGGG - Intronic
954604749 3:51900667-51900689 CTGTGGACCACTAAAGAGCAAGG + Intronic
957146016 3:76424861-76424883 CTTTGGACCACTTCACAGAATGG - Intronic
957572691 3:81968777-81968799 CTATGGACCATTGCAGAGAACGG + Intergenic
957946660 3:87071701-87071723 CTTTGAACCTCCACAGAGCATGG - Intergenic
957999912 3:87737611-87737633 CTATGGACCACTAAAGAGCAAGG - Intergenic
960707404 3:120494158-120494180 CTCTGGACCACTAAATATCAGGG + Intergenic
961971410 3:130972277-130972299 CAGTGGACCAGTACAGTCCATGG - Intronic
962096738 3:132300111-132300133 CTGTGGGCCACTAAAGAGCAAGG - Intergenic
962097377 3:132306356-132306378 CTGTGGACCACTAAAGAGCAAGG + Intergenic
962277075 3:134023578-134023600 CTGTGGACCACTAAAGAGCAAGG + Intronic
962652607 3:137511861-137511883 CTGTAAACCACTAGAGGGCAGGG - Intergenic
963836912 3:150067446-150067468 CTGTGGACTTCTAAAGATCAGGG - Intergenic
963861919 3:150320618-150320640 CTGTGGACTACTAGAGGGCATGG - Intergenic
964810038 3:160653706-160653728 CTGTGAACCTCTAGAGGGCAGGG + Intergenic
964933010 3:162048563-162048585 CTGTGGACCACTAAAGAGCAAGG - Intergenic
970092597 4:12427163-12427185 CTGTGGACCACCAAAGAGCAAGG - Intergenic
972217063 4:36909324-36909346 CTGTGGACCACTGAAGAGCAAGG + Intergenic
972991218 4:44824152-44824174 CTGTGGACCACTAAAGAGCAAGG - Intergenic
973195038 4:47429941-47429963 CTGAGGACCACCACACAACAGGG - Intergenic
975205649 4:71641939-71641961 CTGTGGACCACTAAAGAGCAAGG + Intergenic
977043565 4:92042445-92042467 CTGTGGACCACTTAAGAGCAAGG - Intergenic
977769782 4:100844683-100844705 CTGTGGACTACTAGAGAGTGGGG + Intronic
977901648 4:102429047-102429069 CTGTGGATCACTAAAGAACCTGG + Intronic
977972383 4:103227398-103227420 CTGTGGACCACTAAAGAGCAAGG + Intergenic
978314186 4:107417735-107417757 CTGTGGACCACTAAAGAGCAAGG + Intergenic
980073007 4:128263613-128263635 CTGTGGACCACTAAAGAGCAAGG + Intergenic
980438788 4:132814777-132814799 GTGTGGACCACTAAAGAGCAAGG - Intergenic
980643897 4:135616749-135616771 CAGTGGACCATTAAACAGCATGG - Intergenic
983251851 4:165354485-165354507 CTGTGGACCAGTACCCATCATGG - Intergenic
983266422 4:165512802-165512824 CTGTGCTCCACTGCAGAGGAAGG - Intergenic
983708446 4:170686785-170686807 CTGTGGACCACTAAAGAGCAAGG + Intergenic
983897980 4:173102200-173102222 CTGTGGACCACTAAAGAGCAAGG + Intergenic
987930533 5:24394868-24394890 CTGTGGACCACTAAAGAGCTAGG - Intergenic
988715661 5:33824784-33824806 CTGTGTAACTTTACAGAGCAAGG - Intronic
988787638 5:34579304-34579326 CTGTGGACCTCTCCAGGGCCTGG - Intergenic
988992740 5:36687298-36687320 CTGTGGAACACTAAAGAGCTAGG + Exonic
989096039 5:37782122-37782144 CTGCATACCACTAAAGAGCAAGG - Intergenic
989613521 5:43317367-43317389 CTGTGGACCACCAAAGAGCAAGG - Intergenic
991306085 5:65177587-65177609 CTGTGGACCACTAAAGAGCAAGG + Intronic
995867435 5:116706669-116706691 CTGTGGACCACTAAAGAACAAGG + Intergenic
998007378 5:138665968-138665990 CTGTGGCCTTCTACAGAGGAAGG + Intronic
1000236832 5:159369822-159369844 CTGTGGACAACTAAAGAGCAAGG + Intergenic
1000646570 5:163767031-163767053 CTGTGGACAACTTGAGAACACGG - Intergenic
1001350183 5:170954874-170954896 CTGTGGACCAGTACAGGGGTTGG - Intronic
1001558434 5:172652543-172652565 CTGTGGACCACTAAACAGCAAGG - Intronic
1002999112 6:2314435-2314457 CTGTGGACCACTAAAGAGAAAGG - Intergenic
1005461941 6:26077700-26077722 GTGTGGACCACTAAAGAGCAAGG + Intergenic
1006020411 6:31114582-31114604 CTCTGGACCCCAGCAGAGCAGGG + Intergenic
1006400807 6:33816117-33816139 CTGTGATCCATTGCAGAGCAGGG + Intergenic
1006402700 6:33827012-33827034 CTGGGAGGCACTACAGAGCAGGG - Intergenic
1007446115 6:41907406-41907428 CTGTGGACCAATACTGTGCTAGG - Intronic
1008123476 6:47644129-47644151 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1009635777 6:66262657-66262679 CTGTGGACCACTAACGAGCAAGG + Intergenic
1009747980 6:67844710-67844732 ATGTGTACCACTAGAGTGCAAGG + Intergenic
1010063412 6:71651451-71651473 CAGTGTACCACTCCAGAGAAGGG + Intergenic
1010891577 6:81318902-81318924 CTGTGGACTACTAGAGGGGAAGG + Intergenic
1011130672 6:84049094-84049116 CTGTGGAGTACTACAGAGCCAGG + Intronic
1011263693 6:85493543-85493565 CTTTGAACCACTCCAGAACAAGG - Intronic
1013718110 6:112988372-112988394 CTGTGGACTACTAGAGGGTAGGG - Intergenic
1015010230 6:128337268-128337290 CTGTAGATCACTACACAGAAAGG - Intronic
1015171934 6:130263897-130263919 CTGTGGACCACTAAAGAGCAAGG + Intronic
1015834282 6:137403456-137403478 CTGTGGTCCACTACTGTACATGG - Intergenic
1017093959 6:150787652-150787674 CTGTGGAACAGTCCAGAGCCAGG - Intronic
1018127541 6:160696225-160696247 CTGTGCACCACTACAGCAAATGG + Intergenic
1018191372 6:161311832-161311854 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1018268827 6:162054564-162054586 CAGTGGCCCAGCACAGAGCAAGG + Intronic
1020043884 7:5025216-5025238 CTGTGGACCACTAAAGAGCAAGG - Intronic
1020704279 7:11524176-11524198 CTGAGTACCACCACAGAGCCAGG - Intronic
1020745436 7:12073221-12073243 CTGTGGACCACTAAAGTGCAAGG + Intergenic
1021849350 7:24792288-24792310 CTGTGGACCATTAAAGAGCAAGG - Intergenic
1022892129 7:34712131-34712153 CTGTGAACCACTGCAGATCAGGG + Intronic
1023173248 7:37410463-37410485 CTGTGAGCCACTAAAAAGCAGGG + Intronic
1023290722 7:38666192-38666214 CTGGGGACTACTATAGAGGACGG + Intergenic
1023436335 7:40144025-40144047 CTGTGGACCACTAAAGAGCAAGG - Intronic
1023799114 7:43818112-43818134 CTGTGGACCACAAAAGAGCAAGG + Intergenic
1024542768 7:50492565-50492587 CTGTCGCCCACTCCAGAGGATGG + Intronic
1024812951 7:53235032-53235054 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1027736112 7:81935074-81935096 CTGTGGACCTCTCCAGAGGTTGG - Intergenic
1028838795 7:95403516-95403538 CTGGGGACCACTAGACAGAAGGG - Intergenic
1029580765 7:101435537-101435559 CTGTGATCCACTCCAGAGGAAGG - Intronic
1029822076 7:103156210-103156232 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1030499467 7:110341570-110341592 CTGTGGACTACTAGAGGTCAGGG - Intergenic
1031245776 7:119309560-119309582 CTGGGGACTACTAGAGAGGAAGG + Intergenic
1032170562 7:129581183-129581205 CTGTGGGCCACTAAAGAGCAAGG + Intergenic
1032737997 7:134710687-134710709 CCGTGCTCCCCTACAGAGCAGGG - Intergenic
1033097533 7:138443834-138443856 CTGTGAACCACCAAAGAGCAAGG - Intergenic
1034225156 7:149475797-149475819 CTGTGCCCCACCACAGTGCAGGG + Intronic
1035520336 8:271086-271108 CTGGGGAACACAACAGGGCATGG + Intergenic
1035676537 8:1460530-1460552 CAGTGGATCACAGCAGAGCATGG + Intergenic
1036023370 8:4874096-4874118 GTGTGGAATACTACAGACCAAGG - Intronic
1040993392 8:53376127-53376149 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1041227142 8:55711993-55712015 CTGTGGACCACTAAAGAGCAAGG + Intronic
1041515474 8:58694804-58694826 CTGTGGACCACTAAAGATCAAGG + Intergenic
1044184579 8:89236368-89236390 CTGTGGACCACTAAAGAGGAAGG - Intergenic
1044848903 8:96408761-96408783 CTGGGGACCACTACTGTGGAAGG - Intergenic
1047984367 8:130217188-130217210 CTGTGCGCCACAACAGAGGAGGG - Intronic
1048147003 8:131854899-131854921 CTGTGGACTACTAGAGAGAGTGG - Intergenic
1048361352 8:133699812-133699834 CTGTGAGCCACTCCAGGGCACGG + Intergenic
1048465152 8:134659365-134659387 CAGTGGCCCACCCCAGAGCAGGG + Intronic
1049370944 8:142266638-142266660 CTGTGGAACAGCACAGAGAAAGG - Intronic
1049673606 8:143880213-143880235 CTGGGGGCCACCACAGGGCAGGG - Intergenic
1052508093 9:29380847-29380869 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1053110733 9:35457559-35457581 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1053574213 9:39342324-39342346 CTGTAGACCAATAGAGAGAAAGG + Intergenic
1053838776 9:42170572-42170594 CTGTAGACCAATAGAGAGAAAGG + Intergenic
1054095776 9:60901016-60901038 CTGTAGACCAATAGAGAGAAAGG + Intergenic
1054117238 9:61176955-61176977 CTGTAGACCAATAGAGAGAAAGG + Intergenic
1054590521 9:67005613-67005635 CTGTAGACCAATAGAGAGAAAGG - Intergenic
1056414414 9:86362486-86362508 CTGTGGACCACTGAAGAGCAAGG - Intergenic
1188718596 X:33495389-33495411 CTGTGGAATACTATACAGCAAGG + Intergenic
1188840879 X:35015826-35015848 CTTTGGAGCAGTACAGAACACGG + Intergenic
1190270272 X:48857751-48857773 CTGTGGACCACTAAAGTGCAAGG + Intergenic
1190771224 X:53516401-53516423 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1191639243 X:63412667-63412689 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1191716130 X:64194782-64194804 CTGTGGACCAGCACTGAGCATGG + Intronic
1191917971 X:66222594-66222616 CTGTGGACCACTAGAGAGCAAGG - Intronic
1192915462 X:75646678-75646700 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1193596045 X:83446552-83446574 GTGTGCACCACTAGAGAACAAGG + Intergenic
1193717338 X:84948414-84948436 CTGTGGAGCACTAAAGAGCAAGG + Intergenic
1194352302 X:92835287-92835309 CTGTGGACCCACACAGAGCCAGG + Intergenic
1195846844 X:109238091-109238113 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1196422991 X:115541711-115541733 CTGTGGACCACTAAAGAGCAAGG - Intergenic
1196460075 X:115920497-115920519 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1197109274 X:122754156-122754178 CTGTTGACTACTACAGGGGAAGG - Intergenic
1198742483 X:139855914-139855936 CTGTGGACCACTAAAGAGCAAGG + Intronic
1199278624 X:145974300-145974322 CTGTGGACCACTAAAGAGCAAGG + Intergenic
1199496266 X:148455905-148455927 CTTTGGTCCACTACTGAGCATGG - Intergenic
1199638358 X:149835199-149835221 TTCTGGACCACTAAAGAGCAAGG + Intergenic
1200660611 Y:5952025-5952047 CTGTGGACCCACACAGAGCCAGG + Intergenic
1201260069 Y:12150120-12150142 TTGTGGACCTCTAAAGAGCAAGG - Intergenic
1201911942 Y:19141676-19141698 CTGTGGACCACAAAAAACCAAGG + Intergenic