ID: 1068674564

View in Genome Browser
Species Human (GRCh38)
Location 10:59757493-59757515
Sequence TTTTTAATGTCAAAGCACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068674564_1068674572 25 Left 1068674564 10:59757493-59757515 CCAGAGTGCTTTGACATTAAAAA No data
Right 1068674572 10:59757541-59757563 AGGACTATGCTGAGTACTCATGG No data
1068674564_1068674568 5 Left 1068674564 10:59757493-59757515 CCAGAGTGCTTTGACATTAAAAA No data
Right 1068674568 10:59757521-59757543 GTCTCAGAGCCCCACGGGAAAGG No data
1068674564_1068674573 26 Left 1068674564 10:59757493-59757515 CCAGAGTGCTTTGACATTAAAAA No data
Right 1068674573 10:59757542-59757564 GGACTATGCTGAGTACTCATGGG No data
1068674564_1068674566 -1 Left 1068674564 10:59757493-59757515 CCAGAGTGCTTTGACATTAAAAA No data
Right 1068674566 10:59757515-59757537 ACGATGGTCTCAGAGCCCCACGG No data
1068674564_1068674567 0 Left 1068674564 10:59757493-59757515 CCAGAGTGCTTTGACATTAAAAA No data
Right 1068674567 10:59757516-59757538 CGATGGTCTCAGAGCCCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068674564 Original CRISPR TTTTTAATGTCAAAGCACTC TGG (reversed) Intergenic
No off target data available for this crispr