ID: 1068674568

View in Genome Browser
Species Human (GRCh38)
Location 10:59757521-59757543
Sequence GTCTCAGAGCCCCACGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068674564_1068674568 5 Left 1068674564 10:59757493-59757515 CCAGAGTGCTTTGACATTAAAAA No data
Right 1068674568 10:59757521-59757543 GTCTCAGAGCCCCACGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068674568 Original CRISPR GTCTCAGAGCCCCACGGGAA AGG Intergenic
No off target data available for this crispr