ID: 1068675170

View in Genome Browser
Species Human (GRCh38)
Location 10:59763040-59763062
Sequence CTGAATATACAAACAGACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068675170_1068675172 -3 Left 1068675170 10:59763040-59763062 CCACTGTCTGTTTGTATATTCAG No data
Right 1068675172 10:59763060-59763082 CAGTCTCTTGACTCTTTACAGGG No data
1068675170_1068675171 -4 Left 1068675170 10:59763040-59763062 CCACTGTCTGTTTGTATATTCAG No data
Right 1068675171 10:59763059-59763081 TCAGTCTCTTGACTCTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068675170 Original CRISPR CTGAATATACAAACAGACAG TGG (reversed) Intergenic
No off target data available for this crispr