ID: 1068681710

View in Genome Browser
Species Human (GRCh38)
Location 10:59827068-59827090
Sequence CGTCCCTCCTCCAGTCAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 91}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068681710_1068681717 13 Left 1068681710 10:59827068-59827090 CCTAACTGACTGGAGGAGGGACG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1068681717 10:59827104-59827126 AGCAGGGATAGGATAGAGGAGGG No data
1068681710_1068681713 -3 Left 1068681710 10:59827068-59827090 CCTAACTGACTGGAGGAGGGACG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1068681713 10:59827088-59827110 ACGCTAGTAAGGCTTGAGCAGGG No data
1068681710_1068681718 28 Left 1068681710 10:59827068-59827090 CCTAACTGACTGGAGGAGGGACG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1068681718 10:59827119-59827141 GAGGAGGGAGAAAGTGTTCCAGG No data
1068681710_1068681715 9 Left 1068681710 10:59827068-59827090 CCTAACTGACTGGAGGAGGGACG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1068681715 10:59827100-59827122 CTTGAGCAGGGATAGGATAGAGG No data
1068681710_1068681716 12 Left 1068681710 10:59827068-59827090 CCTAACTGACTGGAGGAGGGACG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1068681716 10:59827103-59827125 GAGCAGGGATAGGATAGAGGAGG No data
1068681710_1068681712 -4 Left 1068681710 10:59827068-59827090 CCTAACTGACTGGAGGAGGGACG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1068681712 10:59827087-59827109 GACGCTAGTAAGGCTTGAGCAGG No data
1068681710_1068681714 2 Left 1068681710 10:59827068-59827090 CCTAACTGACTGGAGGAGGGACG 0: 1
1: 0
2: 0
3: 10
4: 91
Right 1068681714 10:59827093-59827115 AGTAAGGCTTGAGCAGGGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068681710 Original CRISPR CGTCCCTCCTCCAGTCAGTT AGG (reversed) Intronic
903005171 1:20293584-20293606 CGTCCTTACTCCAGTCAGCCTGG + Intronic
904945022 1:34192880-34192902 CCTCCCTCTTCCAGTCATGTTGG - Intronic
905872188 1:41411296-41411318 CCTCCCTCCAGCAGTCAGTGTGG + Intergenic
911160661 1:94679853-94679875 CTTCCCTCTTCCAGGCGGTTTGG - Intergenic
911232328 1:95374308-95374330 CTTCCCTGCTCAAGTTAGTTTGG - Intergenic
912698191 1:111856772-111856794 CCTCCCTCCTCCATCCAGTCTGG - Intronic
913122559 1:115755128-115755150 CTTCCCTCATTCTGTCAGTTTGG - Intronic
914814731 1:151055159-151055181 GGCCCCTCCTCCAGTCAGCACGG + Intronic
919030478 1:192235809-192235831 TGTTCCTCCTGCAGTCAATTAGG + Intergenic
919562435 1:199138444-199138466 AGTACCTCCTGCAGTAAGTTAGG - Intergenic
920343102 1:205288037-205288059 AGTCCCTCCTCTAGTCAGCTTGG - Intergenic
922385194 1:225074729-225074751 CCTTCCACCTCCAGTCAGTTTGG + Intronic
1063066184 10:2611733-2611755 CGTCCCTCCCTCACTCAGCTGGG + Intergenic
1067277458 10:44848025-44848047 GTTCCCTTCTCCAGCCAGTTGGG - Intergenic
1068681710 10:59827068-59827090 CGTCCCTCCTCCAGTCAGTTAGG - Intronic
1073260556 10:102186902-102186924 TTTCCCTCCCTCAGTCAGTTGGG - Intergenic
1076206977 10:128611376-128611398 CTTCCCTTTTCCAGGCAGTTTGG + Intergenic
1077498768 11:2899471-2899493 CTTCCTTCCTCCAGTCAGCCTGG + Exonic
1082193367 11:49273473-49273495 GGTCCCTCCCCCAGCCAGTGGGG - Intergenic
1083630058 11:64090772-64090794 CGTCTCTCCACCAGGCACTTGGG + Intronic
1084304255 11:68271583-68271605 CCTCCCTCCTCCTGTCTCTTGGG + Intronic
1085029013 11:73258454-73258476 AGTCCCTCCTCCACCCAGCTGGG + Intergenic
1089248065 11:117137081-117137103 CTCCCATCCTCCAGTCAGTTAGG + Intergenic
1089258648 11:117207480-117207502 CTCCCATCCTCCAGTCAGTTAGG - Intronic
1090436373 11:126690026-126690048 CGGGCCTCCTCCAGTGACTTAGG - Intronic
1091442916 12:525621-525643 CCTCCCTCCTCAAGTCAGGGCGG + Intronic
1091694360 12:2617996-2618018 GGTCCCTCCTCCAGCCAGCTTGG + Intronic
1093359634 12:18207640-18207662 CCTCCCTTTTCCAATCAGTTTGG + Intronic
1101207905 12:102507310-102507332 CATCTCTGCTCCACTCAGTTGGG + Intergenic
1101918885 12:108916669-108916691 CTTTCCTCCTCCAGTGATTTGGG - Intronic
1111201532 13:84944534-84944556 CTTCCCTCTCTCAGTCAGTTGGG + Intergenic
1111621157 13:90727522-90727544 TGTCCCTCCTCCTGGCAGGTTGG - Intergenic
1115163156 14:30418473-30418495 CCTCCCTCCTCCAGAAAATTAGG - Intergenic
1117582626 14:57168314-57168336 CTTCCCTCCTCCTGTCAGTGGGG - Intergenic
1127465116 15:59236594-59236616 GGTCCCTCCTCCAGACACTCTGG + Exonic
1127506167 15:59599933-59599955 AGTTCCTCCTACAGTTAGTTTGG + Intronic
1130160010 15:81389362-81389384 CCACCCTCCTCCAGTCACTCAGG + Intergenic
1131055596 15:89372615-89372637 CATCTCTCCTCCAGACAGCTGGG + Intergenic
1138353926 16:56362847-56362869 CAGGCCTCCTCCAGTCAGTCGGG + Exonic
1141265413 16:82492379-82492401 CTTCCCTCCTCCAATGAGTTAGG - Intergenic
1147553720 17:41463156-41463178 CCTCCCTACACCAGTCACTTTGG + Intronic
1148462742 17:47847717-47847739 CGCTCCGCCTCCAGACAGTTGGG + Exonic
1152035925 17:77872788-77872810 TGTCCCTCATCAAGTCAGCTGGG - Intergenic
1163639383 19:18452727-18452749 GGCCACTCCTCCAGGCAGTTGGG + Intronic
1164951163 19:32338317-32338339 CCTCCCTGCTCCATTCAGGTTGG + Intergenic
1165727016 19:38119950-38119972 CTTCCCTAGCCCAGTCAGTTAGG + Intronic
1166539246 19:43594712-43594734 GATCCCTCCCCCAGTGAGTTTGG - Intronic
1167497875 19:49830070-49830092 CATCCCTCCTGCTCTCAGTTGGG + Exonic
925640594 2:5982798-5982820 CGTCCCTCCTCCAGACATGGGGG - Intergenic
926040137 2:9666234-9666256 CGTCCCACCTAGAGTCTGTTAGG - Intergenic
926283872 2:11472022-11472044 CTCCCCTCCTCCCGTCACTTGGG - Intergenic
926693118 2:15751022-15751044 AATCCCTCCTCCCTTCAGTTAGG - Intergenic
929120029 2:38476816-38476838 CAGCCCTCCTCAAGTCAGTGTGG - Intergenic
930605750 2:53491454-53491476 CGTCCGTCCTCTAGTGAGTAGGG + Intergenic
933319776 2:80758792-80758814 CCTCTCTCCCCCATTCAGTTTGG + Intergenic
936995488 2:118409689-118409711 CGCCCCTCCCCCAGCCAGTCTGG - Intergenic
939271765 2:139948373-139948395 CTTGCCTCCTCCATTCAGTCAGG - Intergenic
944504125 2:200392232-200392254 CCTCTCTCCTCCTGCCAGTTTGG - Intronic
945546070 2:211153283-211153305 CGTCCCTCAACCAATCACTTGGG - Intergenic
948243838 2:236461836-236461858 CTTTGCTCCTCCAGGCAGTTTGG - Intronic
948505177 2:238423368-238423390 CCTCCCTCTTCCAGCCAGGTCGG - Intergenic
1169346570 20:4833678-4833700 CTTCTCTCCTCCATTCAATTTGG - Intergenic
1173375986 20:42483621-42483643 CATAGGTCCTCCAGTCAGTTTGG + Intronic
1173802828 20:45905308-45905330 CCTCCCTCCTCCAGTCTGACGGG - Intronic
1179924286 21:44525492-44525514 TGTCCCTCCCCCAGACAGTGAGG + Intronic
1181782752 22:25205041-25205063 CGTCCCTCCTACAGTGAATTTGG + Intronic
1182410924 22:30185262-30185284 GGCCCCTCCTCCAGGCATTTGGG + Intergenic
1185172761 22:49303338-49303360 CATCACTCCTCCAGGCAATTAGG + Intergenic
953531422 3:43743052-43743074 TGTCTGTGCTCCAGTCAGTTTGG - Intergenic
953911289 3:46894302-46894324 CTCCTCTCCTTCAGTCAGTTGGG - Intronic
964681375 3:159343653-159343675 CTTCCCTGCTCCAGTGACTTGGG - Intronic
976294659 4:83457785-83457807 CCTCCTTCCTACAGTCAGTATGG - Intronic
980725143 4:136749268-136749290 CTTCCCTCTCTCAGTCAGTTGGG + Intergenic
987035799 5:14017198-14017220 CACCCCTCCTCCAGTAAGGTTGG - Intergenic
988911444 5:35847474-35847496 CGTCCCTCTCTTAGTCAGTTGGG + Intergenic
995111048 5:108428872-108428894 CATCCCTCCTCCAAGGAGTTCGG + Intergenic
995330431 5:110940171-110940193 CATTCCTCGTCCAGACAGTTTGG + Intergenic
1001843977 5:174904475-174904497 CCTTCCTCCTCCAGACTGTTTGG - Intergenic
1008650689 6:53558636-53558658 AGTTCCTCCCACAGTCAGTTCGG + Intronic
1013292120 6:108728765-108728787 CTCCCCTCCCCCATTCAGTTAGG + Intergenic
1015785642 6:136920476-136920498 CGTCCCTGCTCCCGACAGGTGGG - Intergenic
1018144955 6:160877236-160877258 GCTCCCTCCTCCAGACCGTTGGG - Intergenic
1019114813 6:169751586-169751608 CGCCCCTCCTCCAGGCGCTTTGG - Intergenic
1023861196 7:44218510-44218532 CGGCCCTCCCCCAGCCTGTTCGG - Exonic
1023947053 7:44811491-44811513 CCTCCCTCCTCCTGTCACTATGG + Intronic
1029269689 7:99369759-99369781 CTCCCCTCCTGCTGTCAGTTGGG + Intronic
1029292896 7:99516190-99516212 GCTCCCTCCTCGAGTCACTTGGG + Intronic
1031068864 7:117139881-117139903 CATCCCTCTGCCAGTCACTTTGG + Intronic
1033899164 7:146115677-146115699 CCTCCCTGCTCCAGTCAGTCGGG + Intergenic
1035220991 7:157406507-157406529 CCTCCCTCCCCCACTCACTTGGG - Intronic
1036810800 8:11867000-11867022 CGTCACTTCTCCAGTGGGTTTGG + Intronic
1049562445 8:143318481-143318503 CCTCCCTCCACCAGTCCCTTTGG + Intronic
1049570733 8:143369190-143369212 CGTCCCTCCTCCTCTGAGCTCGG + Intronic
1057966967 9:99513680-99513702 GGTCCCTACACCAGTCAGTGTGG - Intergenic
1060746653 9:126139231-126139253 TGTCCCATCTCCAGGCAGTTCGG - Intergenic
1061596472 9:131633285-131633307 CCTCCCTCCTCCAGGCGGTAGGG - Intronic
1061903530 9:133685017-133685039 CGGCCCTCCTACAGGCTGTTGGG - Intronic
1186412889 X:9359363-9359385 CCTCCCTCCTGCAGTGAGTTAGG - Intergenic
1193844822 X:86455600-86455622 CCTCCCTCCTCCAGACCATTTGG + Intronic
1194111252 X:89837236-89837258 CGTTCCTCCCCAAGTTAGTTTGG + Intergenic
1195697019 X:107674649-107674671 CCTCCCTCCCCCAGTCAGGGAGG + Intergenic
1200463913 Y:3491979-3492001 CGTTCCTCCCCAAGTTAGTTTGG + Intergenic