ID: 1068690292

View in Genome Browser
Species Human (GRCh38)
Location 10:59906822-59906844
Sequence TCCCTTGGAACACGTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690292_1068690299 9 Left 1068690292 10:59906822-59906844 CCAGCCACACGTGTTCCAAGGGA 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690292_1068690306 27 Left 1068690292 10:59906822-59906844 CCAGCCACACGTGTTCCAAGGGA 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data
1068690292_1068690307 28 Left 1068690292 10:59906822-59906844 CCAGCCACACGTGTTCCAAGGGA 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690292 Original CRISPR TCCCTTGGAACACGTGTGGC TGG (reversed) Intergenic