ID: 1068690295

View in Genome Browser
Species Human (GRCh38)
Location 10:59906826-59906848
Sequence GCCCTCCCTTGGAACACGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690295_1068690299 5 Left 1068690295 10:59906826-59906848 CCACACGTGTTCCAAGGGAGGGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690295_1068690306 23 Left 1068690295 10:59906826-59906848 CCACACGTGTTCCAAGGGAGGGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data
1068690295_1068690307 24 Left 1068690295 10:59906826-59906848 CCACACGTGTTCCAAGGGAGGGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690295 Original CRISPR GCCCTCCCTTGGAACACGTG TGG (reversed) Intergenic
900362867 1:2298399-2298421 CCTCTCCCTTGGAGCAGGTGTGG + Intronic
900925037 1:5699700-5699722 GTCGTCCCTTGGTACACATGGGG + Intergenic
901490773 1:9595252-9595274 GCCCTCGCTGGCTACACGTGTGG - Intronic
907504918 1:54911107-54911129 TCCATCCCTTGGAATCCGTGAGG - Intergenic
913931495 1:124970283-124970305 GCCCTCCCAGTGAACACTTGCGG + Intergenic
914958913 1:152189089-152189111 GGCCTCCCTTGGTAGAGGTGGGG + Intergenic
918649262 1:186940471-186940493 GTCCTCCCTTGGTACTCATGGGG + Intronic
1063927515 10:10995028-10995050 GCCCTTCCTTGGAGCTCTTGCGG + Intergenic
1068690295 10:59906826-59906848 GCCCTCCCTTGGAACACGTGTGG - Intergenic
1070643708 10:78186915-78186937 GCCCTGCCTTGGATGAAGTGGGG + Intergenic
1075978889 10:126720227-126720249 GGCCTCTCTTGGACCAAGTGCGG + Intergenic
1076796802 10:132802353-132802375 AGCCTCCCTTGCAACACGTGTGG - Intergenic
1081458080 11:43245057-43245079 CTCCTCCCATGGAAGACGTGGGG + Intergenic
1084706454 11:70818890-70818912 GCCCCTCCTGGGACCACGTGAGG + Intronic
1087810741 11:102606890-102606912 TCCCTCCCTTTTAACAAGTGAGG - Intronic
1088653284 11:111976971-111976993 GCCCTCCCTTGGTGGACGAGGGG - Intronic
1092218380 12:6697656-6697678 GGCCTCCCCTGGCACACGGGGGG + Exonic
1099411629 12:82336483-82336505 TCCTTTCCTTGGAACACATGAGG - Intronic
1102914194 12:116740608-116740630 CCCCTCCCATGTAACACATGGGG + Intronic
1107966311 13:45601465-45601487 GCCCTCCCCTGGGAGAGGTGAGG + Intronic
1110720530 13:78756088-78756110 GCCCTTCCCTGGAAAACATGTGG - Intergenic
1123048586 14:105530071-105530093 GCCCTCCCTTCCAACCCGGGCGG - Exonic
1127716184 15:61651418-61651440 GCACTCCCTTGGACCCCCTGGGG - Intergenic
1131673893 15:94651403-94651425 TCCCTTCCTTGGAATCCGTGAGG + Intergenic
1134644128 16:15852841-15852863 GCCCTCCCTTGCAAAAGTTGGGG + Intronic
1136152014 16:28357044-28357066 GCCCTCCCTTAGCAAACCTGGGG + Intronic
1136168267 16:28470912-28470934 GCCCTCCCTTAGCAAACCTGGGG + Intronic
1136194734 16:28644139-28644161 GCCCTCCCTTAGCAAACCTGGGG - Intronic
1136211066 16:28758238-28758260 GCCCTCCCTTAGCAAACCTGGGG - Intronic
1136255787 16:29038196-29038218 GCCCTCCCTTAGCAAACCTGGGG - Intergenic
1136309523 16:29398040-29398062 GCCCTCCCTTAGCAAACCTGGGG + Intronic
1138207801 16:55137656-55137678 GCTCTCCCTTGACACACATGAGG + Intergenic
1147537796 17:41332297-41332319 GCTCTCCCTTGGAGCAGCTGGGG - Intergenic
1151427518 17:74040673-74040695 GCCCCTCCTTGGAACACCTGTGG + Intergenic
1152368647 17:79871554-79871576 GCCTTCCCTGGGTACACGTTAGG - Intergenic
1156015329 18:32540937-32540959 GCCATCCCTTGGCACATGTGTGG + Intergenic
1162809598 19:13155908-13155930 TTCCTTCCTGGGAACACGTGGGG + Intergenic
1162824930 19:13245438-13245460 TCCCTCCCTGGGAACTCCTGGGG + Intronic
1163579257 19:18128608-18128630 GCCCTGCCTTGGAAGTCGGGTGG + Intronic
1167296260 19:48651963-48651985 GCCCTCCGGTGGAACACATGGGG - Intergenic
925167733 2:1728697-1728719 GCCCTCACGAGGAACAGGTGTGG + Intronic
932488489 2:72103411-72103433 GCTCTCCCTTGGGAAACTTGTGG + Intergenic
932691182 2:73914987-73915009 GCCCTTCCTAGGAAAATGTGAGG - Intronic
934750113 2:96788710-96788732 GCCCTCCCATGGGAGAGGTGCGG - Intronic
934766297 2:96881988-96882010 GCCCTCCCTTGGGACATCTCTGG + Intronic
939925458 2:148168547-148168569 GCACTCCATTGGAACCAGTGAGG + Intronic
940883472 2:158969064-158969086 GGCCTCCCCTGGAACCGGTGTGG + Intronic
948778482 2:240302487-240302509 GCCCTCTCTTGGAACAAGGCTGG - Intergenic
948778541 2:240302850-240302872 GCCCTCTCTTGGAACAAGGCTGG - Intergenic
1171245613 20:23607697-23607719 GCACTCCCTTGGAGCACATGTGG - Intergenic
1172523306 20:35582987-35583009 GCCCTGCCCAGGAACACGGGGGG + Intergenic
1172576232 20:36010897-36010919 GCCCTCCCCTTAAACACCTGAGG - Intronic
1175783939 20:61700419-61700441 GGCCTTCCTTGAAAAACGTGTGG + Intronic
1176547810 21:8209038-8209060 GCCCTCCCTTGGCCGTCGTGTGG + Intergenic
1176555702 21:8253240-8253262 GCCCTCCCTTGGCCGTCGTGTGG + Intergenic
1176566753 21:8392075-8392097 GCCCTCCCTTGGCCGTCGTGTGG + Intergenic
1176574637 21:8436273-8436295 GCCCTCCCTTGGCCGTCGTGTGG + Intergenic
1176611250 21:8987565-8987587 GCCCTCCCTTGGCCGTCGTGTGG + Intergenic
1178430467 21:32514191-32514213 GTCATCCCTTGGTACCCGTGGGG - Intronic
1178610025 21:34072738-34072760 GCCCTCCGCTGAAACACGTGGGG + Intergenic
1178745749 21:35248669-35248691 GCCATCCCTTGGTATCCGTGGGG + Intronic
1180008066 21:45032506-45032528 CCCTACCTTTGGAACACGTGGGG + Intergenic
1184816810 22:46878402-46878424 GAGCTACCCTGGAACACGTGAGG - Intronic
1185245260 22:49769878-49769900 GCCCTGCCTTGGGCCACATGGGG - Intergenic
1203252684 22_KI270733v1_random:125323-125345 GCCCTCCCTTGGCCGTCGTGTGG + Intergenic
1203260741 22_KI270733v1_random:170410-170432 GCCCTCCCTTGGCCGTCGTGTGG + Intergenic
952032373 3:29159369-29159391 ACCCTCCCTTGCAACTAGTGTGG - Intergenic
954386510 3:50246700-50246722 GGGCTCCGTGGGAACACGTGGGG - Intronic
956181716 3:66523703-66523725 TGCCTCCCTTGGAACAGGTGTGG + Intergenic
957005802 3:74945258-74945280 GTTCTCCCTTGGAATACATGGGG + Intergenic
961372424 3:126439838-126439860 GGCCTCCCTTGGAATACAGGGGG - Intronic
965133569 3:164732711-164732733 GTCCTCCCTTAGCACACATGGGG - Intergenic
968461597 4:728585-728607 GCCATCCCTTGGTATCCGTGGGG - Intronic
972627737 4:40817638-40817660 GTCCTTCCTTGGTATACGTGGGG - Intronic
983777203 4:171623017-171623039 GCTCTCTCTTGAAACACGTGTGG - Intergenic
983787590 4:171753246-171753268 GCCCTCCCTTGGCACTTATGGGG - Intergenic
985289930 4:188376919-188376941 CCCCTCCCTTGGCACTGGTGGGG - Intergenic
987263724 5:16229502-16229524 GCCCTGCTTTGGAAGATGTGAGG - Intergenic
1000826457 5:166051077-166051099 TCCCTTCCTTGGAACAAATGTGG - Intergenic
1001649050 5:173302313-173302335 GCTCTCCTGTGGAACCCGTGGGG + Intergenic
1010092444 6:72000612-72000634 GCCCTCCCTTTGATGAGGTGTGG - Intronic
1016055655 6:139575247-139575269 GCCCTCCCATGGTAAAAGTGGGG - Intergenic
1025041285 7:55647811-55647833 GCCCTTCTTTGGAACACCTGAGG - Intergenic
1026177139 7:68007813-68007835 CCCCTCCCATGGATCACCTGAGG - Intergenic
1033918748 7:146361378-146361400 ACAGTCCCTTGGTACACGTGGGG - Intronic
1038324599 8:26563104-26563126 GCCCTCCCTTTGAATTCGGGTGG - Intronic
1040293592 8:46137887-46137909 AGCCTCCCTGGAAACACGTGGGG + Intergenic
1042903117 8:73747258-73747280 GCCCACCCTTGGCAGACGAGGGG - Intronic
1043517214 8:81005841-81005863 GTCCTGCCTTGTAACACATGGGG + Intronic
1048428273 8:134342726-134342748 GCCCTCCTTTGGGACCTGTGAGG - Intergenic
1048880823 8:138871175-138871197 GCCGTCCCCTGGGACATGTGTGG + Intronic
1053165747 9:35842486-35842508 GCCATCCCTTGGAACCCCTGCGG + Exonic
1061858067 9:133454042-133454064 GCCTTCCCTTGCAGAACGTGGGG + Intronic
1062094806 9:134697648-134697670 GCACTCCCAGGGATCACGTGGGG + Intronic
1203469088 Un_GL000220v1:108475-108497 GCCCTCCCTTGGCCGTCGTGTGG + Intergenic
1203476909 Un_GL000220v1:152447-152469 GCCCTCCCTTGGCCGTCGTGTGG + Intergenic
1186747434 X:12583940-12583962 ACCCTCCTTTGGAACGTGTGAGG - Intronic
1192166256 X:68829340-68829362 GCTGTCCCTTGGAAGAAGTGGGG - Exonic
1197104786 X:122701134-122701156 GCCATCCCTTGGTATATGTGAGG - Intergenic
1198862376 X:141084590-141084612 TCCCTTCCTTGGAATCCGTGAGG + Intergenic
1198900318 X:141502796-141502818 TCCCTTCCTTGGAATCCGTGAGG - Intergenic
1199722152 X:150549644-150549666 GGGCTCCCTGGGATCACGTGTGG + Intergenic
1200094382 X:153650362-153650384 CCCCTCCCTTGCCACACGAGTGG - Exonic