ID: 1068690295

View in Genome Browser
Species Human (GRCh38)
Location 10:59906826-59906848
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690295_1068690306 23 Left 1068690295 10:59906826-59906848 CCACACGTGTTCCAAGGGAGGGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data
1068690295_1068690299 5 Left 1068690295 10:59906826-59906848 CCACACGTGTTCCAAGGGAGGGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690295_1068690307 24 Left 1068690295 10:59906826-59906848 CCACACGTGTTCCAAGGGAGGGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690295 Original CRISPR GCCCTCCCTTGGAACACGTG TGG (reversed) Intergenic