ID: 1068690296

View in Genome Browser
Species Human (GRCh38)
Location 10:59906837-59906859
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690296_1068690307 13 Left 1068690296 10:59906837-59906859 CCAAGGGAGGGCCTCCGAGCCCC 0: 1
1: 0
2: 4
3: 22
4: 279
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690296_1068690306 12 Left 1068690296 10:59906837-59906859 CCAAGGGAGGGCCTCCGAGCCCC 0: 1
1: 0
2: 4
3: 22
4: 279
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data
1068690296_1068690299 -6 Left 1068690296 10:59906837-59906859 CCAAGGGAGGGCCTCCGAGCCCC 0: 1
1: 0
2: 4
3: 22
4: 279
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690296 Original CRISPR GGGGCTCGGAGGCCCTCCCT TGG (reversed) Intergenic