ID: 1068690296

View in Genome Browser
Species Human (GRCh38)
Location 10:59906837-59906859
Sequence GGGGCTCGGAGGCCCTCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 279}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690296_1068690306 12 Left 1068690296 10:59906837-59906859 CCAAGGGAGGGCCTCCGAGCCCC 0: 1
1: 0
2: 4
3: 22
4: 279
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data
1068690296_1068690299 -6 Left 1068690296 10:59906837-59906859 CCAAGGGAGGGCCTCCGAGCCCC 0: 1
1: 0
2: 4
3: 22
4: 279
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690296_1068690307 13 Left 1068690296 10:59906837-59906859 CCAAGGGAGGGCCTCCGAGCCCC 0: 1
1: 0
2: 4
3: 22
4: 279
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690296 Original CRISPR GGGGCTCGGAGGCCCTCCCT TGG (reversed) Intergenic
900103238 1:971640-971662 GGGGCTGAGAGCCCCTCCCGGGG + Intronic
900154077 1:1197181-1197203 GGGGCTTGGAGGCTCACCCAGGG - Exonic
900291313 1:1924726-1924748 GGGGCTCGGCTTCCCTGCCTAGG + Intronic
900342876 1:2197065-2197087 GGGGCTCGGAGCCCATCCAGAGG - Intronic
900359678 1:2282597-2282619 TGGGTTCGGAGGCCCTGCCCTGG - Intronic
900544205 1:3219504-3219526 GGGGCTGGCAGGCCCTCGGTAGG + Intronic
900897468 1:5493710-5493732 GAGGCTCAGAGGCCAGCCCTCGG + Intergenic
900916683 1:5644480-5644502 GGGGCACTTAGGCCCTCCTTTGG + Intergenic
901086645 1:6614957-6614979 GGGGTTCGCAGGGCCTCCCCAGG + Intronic
901665517 1:10824096-10824118 GGGGCCCAGAGGTCCTGCCTGGG - Intergenic
901769510 1:11523107-11523129 GGGGCTGCAAGTCCCTCCCTGGG + Intronic
901883933 1:12209615-12209637 GGGGCCCAGAGGACATCCCTGGG + Intergenic
902306686 1:15545687-15545709 GGTGCTCTGAGGCCCTCACAGGG - Intronic
903184884 1:21623173-21623195 GGGCCTGGCAGCCCCTCCCTAGG - Intronic
903260998 1:22131889-22131911 GGGGCTCCGAGCTCCTGCCTGGG - Intronic
903666662 1:25012124-25012146 GGCGCTTGGAGAACCTCCCTGGG - Intergenic
904462823 1:30690470-30690492 GGGGACCTGAGGCCCTTCCTAGG + Intergenic
904598683 1:31662201-31662223 GGGGCACCCATGCCCTCCCTCGG - Intronic
906319247 1:44806424-44806446 GGGGGTCAGCGGCCATCCCTGGG - Exonic
913063246 1:115226755-115226777 TGGGCTCACAGGCCCTTCCTTGG + Intergenic
915111061 1:153564959-153564981 GTTGCTCTGAGGCCCTCCCCTGG - Intronic
915290962 1:154883054-154883076 TGGGATCGAAGGCCCTGCCTTGG - Intergenic
916084642 1:161259422-161259444 GGGGCACAGTGGCCCTCCCCGGG - Intronic
917459876 1:175220882-175220904 GGGGCTCACAGTCCCTCTCTAGG + Intergenic
919788621 1:201275900-201275922 GGGCCTCAGAGCCCATCCCTTGG - Intergenic
920381369 1:205536406-205536428 GAGCCTCTGTGGCCCTCCCTGGG - Intergenic
922719539 1:227893259-227893281 GAGTCTCGGAGGCCCTTTCTTGG - Intergenic
923299803 1:232630346-232630368 GGGGCCCGGACGCCCTTCTTGGG + Intergenic
924444607 1:244117585-244117607 GGGGAGGGGAGGCTCTCCCTGGG - Intergenic
924800948 1:247329465-247329487 GGGGCTGGGAAGCTCCCCCTGGG + Exonic
1063009780 10:2011175-2011197 GGGGCTCGGTGTCCCTGCCTGGG + Intergenic
1063347764 10:5327174-5327196 AGGGCTGGGAGGCCCCCCCCTGG - Intergenic
1063966580 10:11350978-11351000 GTGGGTTGGAGGCCCACCCTAGG - Intergenic
1067055207 10:43045965-43045987 GGTGCCCAGAGGCCCTGCCTTGG - Intergenic
1067820068 10:49520691-49520713 GGGGCTCCGAGGCCCTGTTTGGG - Intronic
1067849232 10:49744357-49744379 GGTGCTCAGAGGGCCTCCCTGGG - Intronic
1068690296 10:59906837-59906859 GGGGCTCGGAGGCCCTCCCTTGG - Intergenic
1069634664 10:69917964-69917986 GGGGCTGGGAGGGGGTCCCTGGG - Intronic
1069703081 10:70440531-70440553 GGGGCCAGACGGCCCTCCCTGGG - Intronic
1069750321 10:70741224-70741246 AGGGGTAGGAGGCCCTGCCTGGG - Intronic
1069849611 10:71396707-71396729 GGGGCTCGGCGCCGCTCCCGGGG + Intergenic
1069881566 10:71596868-71596890 GGGGCTGGGAGGCAGGCCCTGGG - Intronic
1069901155 10:71707345-71707367 GGGGCTCAGGGCTCCTCCCTAGG - Intronic
1070257609 10:74825449-74825471 GGGGCTGGGCGGCGCTGCCTCGG + Intergenic
1070572566 10:77651137-77651159 GGGGATGGGAGGCACTGCCTGGG - Intergenic
1070734549 10:78854603-78854625 AGGGGTCTGAAGCCCTCCCTTGG - Intergenic
1072662853 10:97373269-97373291 GTGGCCCAGAGGCCCTCTCTTGG + Intronic
1073001656 10:100290279-100290301 GGGGAGCGGAGGTTCTCCCTGGG + Intronic
1073339281 10:102732807-102732829 AGGGCTGGGAGGCTCTCCCCAGG - Intronic
1073464141 10:103684066-103684088 TGGGCTCTCTGGCCCTCCCTGGG - Intronic
1075872917 10:125783605-125783627 GGGGCTTGGAGGCCATGCCGAGG + Intergenic
1076024864 10:127102930-127102952 GGGGCTCAGGGGCCCTCCCGTGG - Intronic
1076730517 10:132436754-132436776 CGGGCTGGGTGCCCCTCCCTAGG - Intergenic
1076838349 10:133032442-133032464 GGGGCACGGAGGCCATCACTGGG + Intergenic
1077110613 11:860522-860544 GGGGCTCATGGGCCCTCCGTGGG + Intronic
1077283053 11:1754189-1754211 GGGGCCCAGTGCCCCTCCCTGGG + Intronic
1077285438 11:1763398-1763420 GGGGCTCTGAGGCCTGACCTAGG + Intronic
1077331227 11:1984579-1984601 AGGGCTCCGAGGCACTTCCTTGG + Intergenic
1077370734 11:2180503-2180525 GGGGCTCAGAGGGTCTCACTGGG - Intergenic
1078093120 11:8279865-8279887 TGGACTCGGAGGCCGTCCCATGG - Intergenic
1083041243 11:59689344-59689366 GGGGCTCTTAAGCCCTCCCAGGG + Intergenic
1083306109 11:61762769-61762791 GGGGCTCGGAGGGCCTCCTGAGG - Intronic
1084225010 11:67710576-67710598 GGGGCTCCATGGCCCTCCCACGG + Intergenic
1084232001 11:67760112-67760134 TGGGATCGGGGGACCTCCCTTGG + Intergenic
1084262831 11:67990419-67990441 GGGGCTCCATGGCCCTCCCACGG + Intergenic
1084656447 11:70522581-70522603 GGGACTCGGAGGCCCTGGGTAGG - Intronic
1084810562 11:71608686-71608708 GGGGCTCCATGGCCCTCCCACGG - Intergenic
1088741841 11:112773907-112773929 GGTGCTCGGAGGCCCCTGCTGGG - Intergenic
1088775544 11:113078948-113078970 CCGGCTCGGAGGAACTCCCTGGG - Intronic
1088969378 11:114759224-114759246 GAGGCTCCGAGGACCTCCGTGGG - Intergenic
1089178224 11:116563429-116563451 GGGGCTCTGACCCCCACCCTGGG + Intergenic
1089502603 11:118941095-118941117 AGGGTTAGGAGGGCCTCCCTGGG - Intronic
1090274584 11:125410420-125410442 TGAGCTGGGAGCCCCTCCCTCGG - Intronic
1202814208 11_KI270721v1_random:39755-39777 AGGGCTCCGAGGCACTTCCTTGG + Intergenic
1091443156 12:527328-527350 TGGGCTCAGATGCCCTCTCTTGG + Intronic
1091447671 12:553367-553389 GGGGCCAGCAGGCCCTCCCGGGG - Exonic
1097280952 12:57845440-57845462 GGGGCCCGCAGGCCCTCGCGGGG - Intronic
1101842795 12:108340177-108340199 CTGGCTCGGAGGCCCACCCTTGG + Intergenic
1101848331 12:108381886-108381908 GGGGCAGGCAGGCCCTCTCTGGG - Intergenic
1111362413 13:87191661-87191683 GTGGATCAGGGGCCCTCCCTTGG - Intergenic
1111957745 13:94776506-94776528 GGGGCTCGGCGGCTCAGCCTGGG - Intergenic
1112619133 13:101036731-101036753 GGGGTGTGGAGGCCCTGCCTGGG + Intergenic
1113389513 13:109882129-109882151 GGGACTCGAAGGACCTGCCTGGG - Intergenic
1113424391 13:110195986-110196008 GGGGCTGTGGGGCCCTCCCTCGG + Intronic
1118395724 14:65334853-65334875 GGGGCTCAGATGCCCCTCCTGGG + Intergenic
1118601295 14:67472864-67472886 AGGGCTGGGAGACCCTCCCTTGG - Exonic
1119734860 14:76975308-76975330 GGGGAGTGGAGGCCCTCTCTGGG - Intergenic
1121457739 14:94049429-94049451 GGGGATGGGAGGCCATTCCTTGG + Exonic
1121463793 14:94101563-94101585 AGGGCTCACTGGCCCTCCCTGGG - Intronic
1122081688 14:99271271-99271293 GCGGCTCGGACCCCCTCCCCCGG - Intronic
1122425397 14:101602549-101602571 GGAGCTTGGAGGCCCTCCATGGG - Intergenic
1122543202 14:102509180-102509202 GGGGCCCGGAGGCCCAGGCTTGG - Intronic
1122636217 14:103130912-103130934 GGGGCTAGCGGCCCCTCCCTTGG + Intronic
1122651453 14:103229205-103229227 GAGCCTCAGTGGCCCTCCCTGGG + Intergenic
1122904116 14:104794192-104794214 GCGGCTCGGAGCCCTGCCCTCGG - Intronic
1122923157 14:104888237-104888259 GGGGCCCTGAGGCACACCCTGGG - Intronic
1123065118 14:105615013-105615035 GGGGTTGGGAGGCCTTCCCAGGG - Intergenic
1123069319 14:105634447-105634469 GGGGTTGGGAGGCCTTCCCAGGG - Intergenic
1123088420 14:105730236-105730258 GGGGTTGGGAGGCCTTCCCACGG - Intergenic
1123094363 14:105759607-105759629 GGGGTTGGGAGGCCTTCCCAGGG - Intergenic
1123119878 14:105911600-105911622 GGGGCTGAGGGGTCCTCCCTAGG + Intergenic
1124694548 15:31853046-31853068 GGGCCTGGGTGGCCCTCGCTGGG + Intronic
1127710374 15:61591463-61591485 GGGGCTCTGAGAATCTCCCTAGG - Intergenic
1128529111 15:68431965-68431987 GCCTCTCGGAGTCCCTCCCTGGG - Intronic
1129319762 15:74767979-74768001 GGGGCCTGGAGCCCCTCTCTGGG - Intergenic
1129704184 15:77785200-77785222 AGGGCTGGGAGGCTCACCCTTGG - Intronic
1131150073 15:90042248-90042270 TGGGTTCGGAGGCCCTCCTGGGG + Intronic
1132299180 15:100765990-100766012 GTGGCTCTGAGCCCCTCCATCGG + Intergenic
1132390744 15:101436549-101436571 GGGAGTCGGAGGCCATACCTCGG + Intronic
1132584870 16:701707-701729 GGGGCTCGGACGACCTGCGTGGG + Intronic
1132735845 16:1385503-1385525 GGGTCTGGGAAGCTCTCCCTGGG - Intronic
1132746745 16:1439400-1439422 GCGGCTGGGGGGCCTTCCCTGGG - Intronic
1132885381 16:2180022-2180044 GGGTGTCGAAGGCCCGCCCTTGG - Exonic
1132934009 16:2471979-2472001 GGCGCTCGGAGTCCCTGCCTCGG + Exonic
1135015995 16:18925855-18925877 GGGGCTGGGAGGCGCGGCCTAGG - Intronic
1135321616 16:21501682-21501704 GGGGCTGGGAGGCGCGGCCTAGG - Intergenic
1136333091 16:29594792-29594814 GGGGCTGGGAGGCGCGGCCTAGG - Intergenic
1136447787 16:30334880-30334902 GGGGCTGGGAGGCGCGGCCTAGG - Intergenic
1136551059 16:30982842-30982864 GGGGACGGGAGGCCCTCTCTCGG + Intronic
1137558556 16:49488814-49488836 GGGACCCTGAGGCCCTTCCTGGG - Exonic
1137600853 16:49755185-49755207 GGGGCTCCGAGACCCCTCCTGGG - Intronic
1137686555 16:50390729-50390751 GGGGCCCGCAGGCCATCCCAGGG + Intergenic
1138106593 16:54290357-54290379 GGGACTCGGAGGCCCTTCCTGGG + Intergenic
1138516208 16:57536589-57536611 GAGACTCCGCGGCCCTCCCTCGG - Exonic
1139278696 16:65751164-65751186 TGGGCTTGGAGGCTCTGCCTTGG - Intergenic
1139302291 16:65955678-65955700 GAGGATCAGAGGACCTCCCTGGG - Intergenic
1140648783 16:77064573-77064595 TGTGCTCTCAGGCCCTCCCTGGG + Intergenic
1140899577 16:79355431-79355453 GTGGCTCTGAGGTCCTCCCATGG + Intergenic
1140909403 16:79438025-79438047 GGGGCTGGAATGCCATCCCTTGG + Intergenic
1142761004 17:2041933-2041955 GGCGCTCCGAGGCCCGCCCTCGG + Exonic
1143731956 17:8886459-8886481 GGGGCAGGGAGGCCTTACCTCGG + Exonic
1144786858 17:17836873-17836895 GGGCCGCGGCGGCGCTCCCTAGG - Exonic
1147218545 17:38914852-38914874 GGGGCTCAGAGCCCCTGCGTGGG + Intronic
1147612245 17:41808830-41808852 GGGGCCAGGAGACCCTTCCTGGG - Intronic
1150225668 17:63523290-63523312 GGAGCCCGGCGGCCCTCCCCGGG + Intergenic
1150294182 17:63998923-63998945 GGGACTCGGAGGCCCGGCGTGGG + Intronic
1150467103 17:65403131-65403153 GGGGCTCGGAGGCACAGCCTAGG - Intergenic
1151202225 17:72476886-72476908 GGGGGACGGAGGCGCTACCTTGG + Intergenic
1151946578 17:77323077-77323099 GGGGCTCCTAAGCCTTCCCTGGG - Intronic
1152336923 17:79703853-79703875 GTGCCTCTGAGCCCCTCCCTCGG - Intergenic
1152581007 17:81165653-81165675 GGGGCACGGAGGGCCTGCGTGGG - Intronic
1152648860 17:81482764-81482786 GGGGCTGGGAGTCCTTCCATGGG - Intergenic
1152735713 17:81995919-81995941 GGTGCCCGGAGGGCTTCCCTGGG + Intronic
1152736885 17:82001421-82001443 TGGGCTCTGAGGCTGTCCCTAGG + Intronic
1152813709 17:82394648-82394670 AGGGCTCAGAGGTCCCCCCTGGG - Intronic
1152848112 17:82614975-82614997 GGGGCTCGGAGGCCAGACCAGGG + Exonic
1153746694 18:8186915-8186937 TGGGCAAGGAGGGCCTCCCTTGG + Intronic
1155178780 18:23325033-23325055 GGGGCTCGGAGACGCTCTCTTGG - Intronic
1159798409 18:72868930-72868952 GGTGCAGGGAGTCCCTCCCTGGG + Intergenic
1159863298 18:73674490-73674512 GAGGCTAGCAAGCCCTCCCTGGG + Intergenic
1160537510 18:79602993-79603015 GGAGTTCCCAGGCCCTCCCTGGG - Intergenic
1160963520 19:1735278-1735300 GGGCCTCCCAGGACCTCCCTGGG + Intergenic
1160966376 19:1748649-1748671 GGGGCTCGGCGGCCCGCGGTGGG - Intergenic
1161297704 19:3528008-3528030 GTGGCTGGGAGGCCCTGACTGGG - Intronic
1161321706 19:3644418-3644440 CGGGCTCGCAGTCCCTCCCCAGG - Intronic
1161698458 19:5782988-5783010 GTGGCTCCCAGGTCCTCCCTGGG + Exonic
1161944846 19:7429115-7429137 GGGGCTCTGAGGCTCCCCCCTGG + Intronic
1161963290 19:7534581-7534603 GGAGCCCGGACGCCCTCCCCAGG + Intronic
1161991327 19:7685999-7686021 GGGTCTCAGAGGACCTGCCTGGG - Exonic
1163257438 19:16165323-16165345 GGGTCTCGGGTGCCCTCCCAGGG - Intronic
1163597512 19:18228773-18228795 GGGGCTTGGAGAGCCTCCCAGGG - Intronic
1163906726 19:20154980-20155002 TCGGCTCGGGGGACCTCCCTTGG + Intergenic
1164756280 19:30692014-30692036 GGGCCTGGGAGGCCCCCTCTCGG + Intronic
1165351597 19:35278868-35278890 GGGGCTCGGGAGTCATCCCTGGG + Intronic
1165434153 19:35787538-35787560 GGGACTCCGAGGCCCTGCCCAGG + Exonic
1167095472 19:47373020-47373042 GGGGCTCAGTGGTCCTCCCAGGG - Intronic
1167638018 19:50666624-50666646 GGGTCTCGGAGTCCCCCGCTGGG + Exonic
1167663978 19:50812505-50812527 GTGGCTGGGAGGACCACCCTGGG + Intergenic
1168059576 19:53883383-53883405 GGTGCTGGGGGCCCCTCCCTCGG + Intronic
1168348073 19:55660446-55660468 GGGGCTCGCAGGCCCACTGTTGG + Intronic
927022263 2:19029451-19029473 TGGGCTCTGAGTACCTCCCTTGG - Intergenic
927200203 2:20573435-20573457 GGGGCTTGGGGGGTCTCCCTGGG - Intronic
927703424 2:25282452-25282474 GGGGCTCCTCGGCCCTCCTTGGG + Exonic
931947942 2:67331931-67331953 TGGGATCGGGGGACCTCCCTTGG + Intergenic
932058163 2:68467608-68467630 GAGCCTTTGAGGCCCTCCCTCGG + Exonic
932493933 2:72137485-72137507 GGGGCTGGAAGGCACTCCCCAGG - Intronic
933552661 2:83794034-83794056 TCGGATCGGAGGACCTCCCTTGG - Intergenic
938103344 2:128513028-128513050 AGGGCTGGCAGGCCCTCACTGGG + Intergenic
944535672 2:200707299-200707321 GGGGCTTCCATGCCCTCCCTGGG + Intergenic
945823696 2:214696128-214696150 AGGGCTGAGAGGCTCTCCCTTGG - Intergenic
947524639 2:230870671-230870693 TGGGCTCGGAGGCCCCACCGAGG - Intronic
947542546 2:230988883-230988905 GGAGGTAGGAGGCCCTACCTGGG - Intergenic
947833568 2:233159211-233159233 GGGGCACAGAGGCCCAGCCTGGG - Intronic
947904997 2:233754878-233754900 GGGGGTCAGAGGAACTCCCTGGG - Intronic
947964376 2:234267198-234267220 GGGGCTTCCAGGCCCTCCCTGGG - Intergenic
948065301 2:235074272-235074294 GGGGTTCAGAGGGCATCCCTAGG - Intergenic
948287047 2:236793892-236793914 CTGGCTCGGCCGCCCTCCCTTGG + Intergenic
948427406 2:237896458-237896480 GGGGCTGCTTGGCCCTCCCTGGG - Intronic
948698361 2:239745486-239745508 GGGGCTGGGAGCCCCTGCCAGGG - Intergenic
948803899 2:240444867-240444889 GGGGCCAGGAGGCCCATCCTTGG + Intronic
1168953747 20:1819919-1819941 GGGGTGCGGAGGCCCACTCTGGG - Intergenic
1169140960 20:3227351-3227373 GGGGAGGGGAAGCCCTCCCTGGG - Intergenic
1172277087 20:33685843-33685865 GGGGCCCGGAGGCCCAACCCCGG + Intronic
1172624363 20:36338781-36338803 GGGGCTGGGAGGTCCTCCCTGGG + Intronic
1173118571 20:40269520-40269542 TGGGATCGGGGGACCTCCCTTGG + Intergenic
1173528372 20:43749987-43750009 GGCGCTGGGCGGCTCTCCCTGGG + Intergenic
1174475799 20:50795004-50795026 GGGCCTCGGAGCCCCGCCCCCGG - Exonic
1175218601 20:57404550-57404572 GGGTCTCGGAGGCCTCCCTTGGG - Intronic
1175503424 20:59466190-59466212 GGGGCTCGGATGGCCTTCATGGG - Intergenic
1176112790 20:63418157-63418179 TGGTCTCGCAGGCCCTCCCTCGG + Intronic
1176289727 21:5037644-5037666 GGGGCCCAGGGGTCCTCCCTGGG - Intronic
1176547808 21:8209027-8209049 CGGCCTCGGTCGCCCTCCCTTGG + Intergenic
1176555700 21:8253229-8253251 CGGCCTCGGTCGCCCTCCCTTGG + Intergenic
1176566751 21:8392064-8392086 CGGCCTCGGTCGCCCTCCCTTGG + Intergenic
1178872091 21:36385521-36385543 GGGGCCCAGGGGCCCGCCCTCGG - Intronic
1179867503 21:44225943-44225965 GGGGCCCAGGGGTCCTCCCTGGG + Intronic
1180211461 21:46297488-46297510 GGGGCGCGGACACCTTCCCTGGG + Intronic
1180971876 22:19820147-19820169 TGGGCAGGGAGGCCCTCCTTGGG + Intronic
1181513757 22:23400331-23400353 GGGCATGGGAGGCCCACCCTCGG + Intergenic
1182049041 22:27299273-27299295 GGGGCTCAGATGCGCGCCCTCGG + Intergenic
1182516543 22:30862215-30862237 GGGGAGCGGAAGCCCTGCCTTGG - Intronic
1183092159 22:35529903-35529925 AGGGCTCTCTGGCCCTCCCTGGG - Intergenic
1183510278 22:38230603-38230625 GGGTCTGGGAGGCCCTGCCGTGG - Intronic
1183958897 22:41399079-41399101 GGGGCTCTGTGTCCTTCCCTGGG + Exonic
1183971578 22:41481550-41481572 GGAGGTCGGAGGTCTTCCCTTGG - Intronic
1184305076 22:43592707-43592729 GGGGCTCTGTGGCCGTCCATTGG - Intronic
1184786775 22:46675872-46675894 GGGGCCCTGAGCCCCTGCCTCGG + Intronic
1185061657 22:48610165-48610187 GGGGCAGGGAGGCCTTCCCGTGG + Intronic
1185297949 22:50063583-50063605 GGCCCTCGGAGGCCCTCACCAGG + Intronic
1185301700 22:50084299-50084321 CGGCCCCTGAGGCCCTCCCTAGG + Intronic
1203252682 22_KI270733v1_random:125312-125334 CGGCCTCGGTCGCCCTCCCTTGG + Intergenic
950080632 3:10219681-10219703 GTGGCTCGGACCCCCTCCCCTGG + Exonic
951763055 3:26165435-26165457 TCGGATCGGAGGACCTCCCTTGG - Intergenic
952344039 3:32467833-32467855 GCTGGGCGGAGGCCCTCCCTGGG + Intronic
953662574 3:44901734-44901756 GGGGCTGGGAGTCCCTCCCTTGG - Intronic
956560127 3:70565806-70565828 GGGGCTTCCATGCCCTCCCTGGG + Intergenic
957078267 3:75618361-75618383 GGGGCTCCATGGCCCTCCCACGG + Intergenic
959020172 3:101180385-101180407 GGAGCTTGCATGCCCTCCCTGGG - Intergenic
961711933 3:128834475-128834497 TCGGTTCGGAGGACCTCCCTTGG - Intergenic
961831769 3:129626814-129626836 GGGGCTCGGGCGCCCTCCCTGGG - Intergenic
962459066 3:135591975-135591997 GTGGGTCTGAGGCACTCCCTGGG - Intergenic
962945163 3:140162214-140162236 GGGTCTCAGAGACCCTCCCAAGG + Intronic
967233640 3:187364797-187364819 GGGGCATGGAAGCCCACCCTGGG - Intergenic
968812158 4:2804991-2805013 GGGGCTCCCTGCCCCTCCCTTGG + Intronic
968940598 4:3635531-3635553 TGGGCTCTGAGGCTCACCCTGGG - Intergenic
969021338 4:4142334-4142356 GGGGCTCCATGGCCCTCCCACGG + Intergenic
969566834 4:7983729-7983751 GGGGCCCTGAGGGCCTCCCCCGG + Intronic
969732524 4:8965082-8965104 GGGGCTCCATGGCCCTCCCACGG - Intergenic
969792103 4:9499165-9499187 GGGGCTCCATGGCCCTCCCACGG - Intergenic
972788144 4:42346340-42346362 GGAGCCGGCAGGCCCTCCCTTGG - Intergenic
980765768 4:137301738-137301760 GGAGCTCCCATGCCCTCCCTGGG + Intergenic
985666228 5:1182783-1182805 AGGGCTTGGACGCCCTTCCTCGG - Intergenic
985843317 5:2325860-2325882 AGGGCTGGGAGGCCCTGCATGGG - Intergenic
992320823 5:75611732-75611754 GGGGCGCGGCCGCCCTGCCTTGG + Exonic
994238446 5:97392459-97392481 GTGGGTTGGAGGCCCACCCTGGG + Intergenic
995582617 5:113617386-113617408 GGGGCTTGGCGGCCCACACTTGG + Intergenic
997388118 5:133489761-133489783 AGGGCCCTGATGCCCTCCCTAGG + Intronic
997589148 5:135062379-135062401 TGGGGTCGGAGGCCCTGCCTTGG + Intronic
998159773 5:139806845-139806867 GGGGCCCAGAGTCCCTGCCTGGG - Intronic
998388927 5:141774449-141774471 GGGGCTCACAGCCCCTCCCTGGG - Intergenic
998468457 5:142364540-142364562 GGGCCTGGGAGGGCCCCCCTTGG + Intergenic
999432381 5:151535509-151535531 GGGGCTCCCATGTCCTCCCTGGG - Intronic
999762291 5:154711913-154711935 GTGGTCAGGAGGCCCTCCCTAGG - Intergenic
1000935965 5:167303232-167303254 TGGGATCGGGGGACCTCCCTTGG - Intronic
1001261455 5:170233135-170233157 TGGCCTCGGAGCCTCTCCCTGGG + Exonic
1001489779 5:172147187-172147209 GGGGCTTCCATGCCCTCCCTGGG + Intronic
1001490374 5:172150658-172150680 TGGGCTCAGAGGCCAGCCCTTGG - Intronic
1001568602 5:172716043-172716065 CGGGCTGGGAGGCCCTCTGTGGG - Intergenic
1002385034 5:178860193-178860215 GGGGCTCCGAGGGCCTCTGTGGG + Intronic
1003175129 6:3748531-3748553 GGTGCTTGGAGGCCATCCCTGGG - Intronic
1003348316 6:5292106-5292128 GGGGCTGGGAGACCTTTCCTTGG + Intronic
1004923847 6:20401488-20401510 GGGGCGCGGAGTCCCTGCCCAGG + Intergenic
1006444703 6:34073789-34073811 GGGCCTCGCAGGGCCTCCGTGGG - Intronic
1006855217 6:37128239-37128261 TGGTCTCGGAAGGCCTCCCTGGG - Intergenic
1012733553 6:102910931-102910953 TGGGCTCGGCGGCCCGCACTCGG - Intergenic
1018156448 6:160989934-160989956 GGGGCTGTGAGGCGCTCACTGGG + Intergenic
1018595184 6:165471596-165471618 AAGGCTGGGAGGCCCTCCATGGG - Intronic
1018782432 6:167080261-167080283 GGAGCTCTCAGGCCCTCCCAGGG + Intergenic
1019540914 7:1550600-1550622 GGGGCTCGGTGGACCTGCCCTGG - Intronic
1020105584 7:5420955-5420977 GGGGCTCGGCGACTCTCCTTCGG - Intronic
1020111561 7:5450901-5450923 GGGGCTGAGAGGCCCAGCCTGGG - Intronic
1020308761 7:6854363-6854385 GGGGCTCCATGGCCCTCCCACGG + Intergenic
1022500261 7:30878280-30878302 GGGGTTCTGGGGCCCTCACTGGG + Intronic
1026100171 7:67378106-67378128 GGCTCTCGGAAGCCCTGCCTTGG - Intergenic
1026878738 7:73894796-73894818 GGGGCTGGGGGGCCCTCCAGAGG - Intergenic
1033238301 7:139655950-139655972 GGGACTCAGGGGCCTTCCCTTGG + Intronic
1034222949 7:149460036-149460058 CGGGCTCGGCGGCCCGGCCTGGG - Intronic
1035360940 7:158314002-158314024 AGGGCTCCGGGGCCCTGCCTGGG - Intronic
1035730937 8:1853213-1853235 GGGGCACAGAGCCTCTCCCTAGG + Intronic
1037239523 8:16760799-16760821 TGGGCTCGGCGGCCCACACTGGG - Intergenic
1037702133 8:21284860-21284882 GGGGCTCAGAGACCTTCCTTGGG - Intergenic
1038816820 8:30912652-30912674 GGCCCTCGGAGGCCCACCTTTGG + Intergenic
1040413896 8:47180954-47180976 GGGGCTGGGAGACCTTCCCTTGG + Intergenic
1047628527 8:126681009-126681031 GAGGCTAGGAGGCCATCCCTAGG - Intergenic
1048339763 8:133529543-133529565 GGGGCCCGGAGCCCCTCCTCTGG - Intronic
1049402447 8:142434562-142434584 AGGGCTCAGGGACCCTCCCTTGG + Intergenic
1052791158 9:32876722-32876744 TGGGCTCGCCGGCCCTCCCATGG - Intergenic
1054457595 9:65443103-65443125 CAGGCTAGGAGACCCTCCCTGGG - Intergenic
1057014831 9:91642431-91642453 GGGGCTCAGAGGCCCCTGCTTGG - Intronic
1057131258 9:92656037-92656059 GGGCAGCGGAGGCCCTTCCTGGG + Intronic
1057198735 9:93129391-93129413 GGGGCTCAGAGGCCATCCTGGGG - Intronic
1060405056 9:123368904-123368926 GGGGCTCTGTGGACCTTCCTGGG + Intronic
1060718288 9:125955222-125955244 GGGGCTCGCAGGTTCTCCCCAGG - Intronic
1060731945 9:126044276-126044298 GGGGCTCTGAGGCCCCCACCTGG + Intergenic
1061185401 9:129049913-129049935 GGGTTCCGGAGGCCGTCCCTGGG - Exonic
1061190736 9:129081240-129081262 GGGACTGAGAGGCCGTCCCTGGG - Intronic
1061974170 9:134060026-134060048 GAGGCTCAGAGACCCTCCCTGGG + Intronic
1062474053 9:136718940-136718962 GGGGCCCGGAGGCCTCCCCTGGG - Intronic
1062624973 9:137438553-137438575 GGGGCTCAGACGGCCTCCCGTGG + Intronic
1062624986 9:137438592-137438614 GGGGCTCAGACGGCCTCCCGTGG + Intronic
1185892346 X:3832837-3832859 GGGGCTCGGTGGCTCACCCCTGG - Intronic
1185897454 X:3871256-3871278 GGGGCTCGGTGGCTCACCCCTGG - Intergenic
1185902573 X:3909688-3909710 GGGGCTCGGTGGCTCACCCCTGG - Intergenic
1187341674 X:18426100-18426122 GGGGCGCGCAGGCCCCTCCTCGG - Intronic
1189693035 X:43636705-43636727 GGTGCTGGGGGGCCATCCCTAGG + Intergenic
1196221285 X:113113945-113113967 TCGGATCGGAGGACCTCCCTTGG - Intergenic