ID: 1068690297

View in Genome Browser
Species Human (GRCh38)
Location 10:59906848-59906870
Sequence GCTTAGATCAGGGGGCTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690297_1068690306 1 Left 1068690297 10:59906848-59906870 CCTCCGAGCCCCCTGATCTAAGC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data
1068690297_1068690307 2 Left 1068690297 10:59906848-59906870 CCTCCGAGCCCCCTGATCTAAGC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690297_1068690313 26 Left 1068690297 10:59906848-59906870 CCTCCGAGCCCCCTGATCTAAGC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690297 Original CRISPR GCTTAGATCAGGGGGCTCGG AGG (reversed) Intergenic
900151109 1:1179760-1179782 GCTTGGAGCAGGGGGCAGGGAGG - Intronic
900791495 1:4683878-4683900 GCTTAGGGCAGGGGGCACTGAGG + Intronic
902936806 1:19770248-19770270 GCTTAGACCAGGGGCCTGGGTGG + Intronic
920826709 1:209429672-209429694 GGCTAGATCAGGGGGCTCATTGG + Intergenic
1068690297 10:59906848-59906870 GCTTAGATCAGGGGGCTCGGAGG - Intergenic
1071456331 10:85854211-85854233 GCTTGGATCAGGGGGCTGCATGG - Intronic
1072628215 10:97128060-97128082 CCCGAGAGCAGGGGGCTCGGTGG - Intronic
1076060152 10:127407767-127407789 TCTTTGATCAGGGGACACGGGGG - Intronic
1077437771 11:2550982-2551004 GCTGAGCTCAGTGGGCTTGGTGG + Intronic
1080651867 11:34229034-34229056 GCTTAAATCTGGGGGTGCGGAGG + Intronic
1081775580 11:45674132-45674154 GCTTAGATCATGGTTCTCAGTGG - Intergenic
1087175158 11:95089616-95089638 GCTGAGACCAGGCGGCGCGGAGG + Intergenic
1105518438 13:21110993-21111015 GGTTAGATCAGGGTGCTGGCAGG - Intergenic
1106114026 13:26801652-26801674 GCTTACAGCAGTGGGCTCAGCGG + Intergenic
1108648094 13:52450375-52450397 GCTTAGCTCACGGCCCTCGGCGG - Intronic
1113565641 13:111318116-111318138 GCTGAGAGCAGGGGATTCGGGGG - Intronic
1113891601 13:113738643-113738665 ACTGGGATCAGGGGGCTTGGAGG + Intergenic
1121013877 14:90536677-90536699 GCTTAGACCAAGGGGCGTGGAGG - Exonic
1121546568 14:94767832-94767854 GCTTGGAGCAGTGGGCTCCGTGG + Intergenic
1127459804 15:59188286-59188308 GCTTGGAACTGGGGGCTTGGGGG - Intronic
1129124231 15:73424072-73424094 GCTTAGAACCGGGAGCTTGGGGG + Intergenic
1129685173 15:77681873-77681895 GCTTAGCCCAGGGGGCTCATTGG - Intronic
1131126870 15:89866325-89866347 GCTTAGACTAGGGGGTTGGGAGG + Intronic
1132112239 15:99110058-99110080 GCTTGGACCAGGGGTCTCAGAGG + Intronic
1134441437 16:14301873-14301895 GCTTCAAACAGGGGGCACGGAGG - Intergenic
1148195507 17:45709997-45710019 GCCTTGATCAGGGGTCTCAGTGG - Intergenic
1148770069 17:50061373-50061395 GCTGAGTTGAGGGGGCTGGGAGG + Intronic
1148907562 17:50920972-50920994 TCTTAGATCCGGGAGCTCGTGGG - Intergenic
1157862615 18:51154352-51154374 GCTCAGTCCAGGGGGCTCGCAGG - Intergenic
1158011409 18:52732490-52732512 CCTTAGAGCAGGGGGCAGGGTGG + Intronic
1163476508 19:17529191-17529213 GCCTAGCTCATGGGGCTGGGGGG + Intronic
926630206 2:15128993-15129015 GGTTTGAGCAGGGGGCTGGGCGG + Intergenic
929427168 2:41855178-41855200 GCTTGGGTCAGGGGACTCTGAGG - Intergenic
933974885 2:87501182-87501204 GCTGAGGTCACGGGGCACGGTGG - Intergenic
934554553 2:95280462-95280484 TCTTAGACCAGGGGGCTCGAAGG - Intronic
936318941 2:111449631-111449653 GCTGAGGTCACGGGGCACGGTGG + Intergenic
938294272 2:130167729-130167751 GTGTGGATCAGGGGGCTGGGGGG - Intronic
938462377 2:131506161-131506183 GTGTGGATCAGGGGGCTGGGGGG + Intergenic
948547789 2:238745234-238745256 CCTTAGAGCAGGGGGCGAGGTGG - Intergenic
1168829972 20:840512-840534 GATTAAATGAGGGGGCTCTGGGG + Intronic
1173935203 20:46855744-46855766 ACTTAGATGAGGGGGTTCAGAGG + Intergenic
1176066840 20:63202212-63202234 ACTTAGACCAGGTGGCCCGGTGG - Intronic
1182511764 22:30825054-30825076 GCTTAGATCTGGGAGCAGGGTGG - Intronic
1183092948 22:35535887-35535909 GCTTGGATCATCGGGCTCAGTGG + Intergenic
1184499384 22:44862557-44862579 GCTGCCATCAGGGGACTCGGAGG - Exonic
951299937 3:20983878-20983900 GCTGAGATCATGGGGTTGGGGGG + Intergenic
954150151 3:48653245-48653267 GGTGAGATCAGAGGGCTCAGAGG + Intronic
955820972 3:62895056-62895078 CCTCAGATAAGGGAGCTCGGGGG + Intergenic
960314640 3:116161608-116161630 GCTTAGAACAGGGAGGTCAGTGG - Intronic
961318219 3:126055037-126055059 GCTCAGATTAGGAGGCTGGGTGG + Intronic
966913366 3:184571444-184571466 GGTGAGATGAGGGGGCACGGAGG - Intronic
968957678 4:3727488-3727510 GCAGAGATCAGGGGTCTCAGGGG - Intergenic
973861509 4:55069564-55069586 GCTTTGTTCAGGGGTCTGGGCGG - Intergenic
986910397 5:12548710-12548732 GGTGAGATCAGGGAGCTTGGAGG + Intergenic
996509186 5:124299802-124299824 CCTTAGGTCAGGTGGGTCGGGGG + Intergenic
999232209 5:150068370-150068392 CCTGACCTCAGGGGGCTCGGAGG - Intronic
1006624994 6:35391474-35391496 GCTTACATCAGGAGGCACAGTGG + Intronic
1007268903 6:40620704-40620726 GCTAAGCTCAGGAGGCTGGGAGG + Intergenic
1013046305 6:106488927-106488949 GCTTAGATCCTGGGGATGGGAGG + Intergenic
1017798462 6:157869582-157869604 GCTTAGCTCAGGGCGCTGGCAGG - Intronic
1018203440 6:161415621-161415643 GCTTAGTTCCGGGCGGTCGGGGG - Intronic
1020116982 7:5481545-5481567 GGTGACATGAGGGGGCTCGGGGG - Exonic
1036063554 8:5353501-5353523 GCTTGAATCTGGGGGGTCGGAGG - Intergenic
1037816760 8:22116632-22116654 GCTGATGTCAGGGGGCTCGCAGG - Intronic
1038613261 8:29072147-29072169 GCTTCACTCAGGGGGCTGGGGGG + Exonic
1042622094 8:70717594-70717616 GCATAGAGCAGGGGGCTCCTGGG + Intronic
1044819513 8:96145944-96145966 CCTTAGATCAGGGTGCTCAGGGG - Intronic
1058162572 9:101585701-101585723 GCTTGGATCAGGGTGGTTGGTGG - Intronic
1062015468 9:134289012-134289034 GCTTGGATGAGGGCGCTCCGTGG - Intergenic
1199606765 X:149584781-149584803 TCTTAGATCTGGGGGCGGGGGGG - Intronic
1199632358 X:149784587-149784609 TCTTAGATCTGGGGGCGGGGGGG + Intronic