ID: 1068690297

View in Genome Browser
Species Human (GRCh38)
Location 10:59906848-59906870
Sequence GCTTAGATCAGGGGGCTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690297_1068690306 1 Left 1068690297 10:59906848-59906870 CCTCCGAGCCCCCTGATCTAAGC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data
1068690297_1068690307 2 Left 1068690297 10:59906848-59906870 CCTCCGAGCCCCCTGATCTAAGC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690297_1068690313 26 Left 1068690297 10:59906848-59906870 CCTCCGAGCCCCCTGATCTAAGC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690297 Original CRISPR GCTTAGATCAGGGGGCTCGG AGG (reversed) Intergenic