ID: 1068690298 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:59906851-59906873 |
| Sequence | TGGGCTTAGATCAGGGGGCT CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 207 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 22, 4: 184} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1068690298_1068690306 | -2 | Left | 1068690298 | 10:59906851-59906873 | CCGAGCCCCCTGATCTAAGCCCA | 0: 1 1: 0 2: 0 3: 22 4: 184 |
||
| Right | 1068690306 | 10:59906872-59906894 | CACGGCCGCCCAGCCTCTTCCGG | No data | ||||
| 1068690298_1068690313 | 23 | Left | 1068690298 | 10:59906851-59906873 | CCGAGCCCCCTGATCTAAGCCCA | 0: 1 1: 0 2: 0 3: 22 4: 184 |
||
| Right | 1068690313 | 10:59906897-59906919 | TCGCGCCCGCCCCGAGAAAAAGG | No data | ||||
| 1068690298_1068690307 | -1 | Left | 1068690298 | 10:59906851-59906873 | CCGAGCCCCCTGATCTAAGCCCA | 0: 1 1: 0 2: 0 3: 22 4: 184 |
||
| Right | 1068690307 | 10:59906873-59906895 | ACGGCCGCCCAGCCTCTTCCGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1068690298 | Original CRISPR | TGGGCTTAGATCAGGGGGCT CGG (reversed) | Intergenic | ||