ID: 1068690298

View in Genome Browser
Species Human (GRCh38)
Location 10:59906851-59906873
Sequence TGGGCTTAGATCAGGGGGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 184}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690298_1068690307 -1 Left 1068690298 10:59906851-59906873 CCGAGCCCCCTGATCTAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 184
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690298_1068690313 23 Left 1068690298 10:59906851-59906873 CCGAGCCCCCTGATCTAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 184
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690298_1068690306 -2 Left 1068690298 10:59906851-59906873 CCGAGCCCCCTGATCTAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 184
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690298 Original CRISPR TGGGCTTAGATCAGGGGGCT CGG (reversed) Intergenic
902209679 1:14895506-14895528 TGGGATCACATCAGGGGTCTGGG + Intronic
902936805 1:19770245-19770267 GTGGCTTAGACCAGGGGCCTGGG + Intronic
903130414 1:21275791-21275813 GGGCCTTAGATGAGGGGGCCTGG - Intronic
904452964 1:30628221-30628243 TGGGCTCAGTGCACGGGGCTGGG + Intergenic
904810134 1:33158177-33158199 TGTGTTTAGGACAGGGGGCTGGG + Intronic
905537058 1:38730299-38730321 TGGGCTCAGACCAGGGTTCTGGG + Intergenic
906047486 1:42843177-42843199 TGGGCCAAGGTCAGGGGGCAAGG - Exonic
906941295 1:50257794-50257816 TGTGTTTAGACCAGGGGGATTGG + Intergenic
910787951 1:91021494-91021516 GGGGCCGAGATCAGGCGGCTTGG - Intronic
910908608 1:92209618-92209640 AGTGCTTAGACCAGGGGGATGGG + Intergenic
913322375 1:117598085-117598107 TGGGCTTGGCCCAGGGGTCTTGG + Intergenic
915450515 1:156002016-156002038 TGTGGTTAGATTAGGGGGCTGGG - Intronic
915545039 1:156592261-156592283 TGTGCCTAGGCCAGGGGGCTGGG - Intronic
915956014 1:160220585-160220607 TGGCCTTAGATGACTGGGCTGGG + Intronic
916071235 1:161171348-161171370 TGGTCCTGGCTCAGGGGGCTGGG - Exonic
919983177 1:202655164-202655186 TGGGCTTAGAGGAGGGGTCTGGG + Intronic
920868066 1:209769689-209769711 TGGGGGTAGAGGAGGGGGCTCGG - Intronic
921952147 1:220941571-220941593 TGGGATAAGATCAGGATGCTTGG + Intergenic
1064978699 10:21144782-21144804 TGGCCTTATATGATGGGGCTTGG - Intronic
1067314414 10:45148462-45148484 TTGGTGTAGATCAGGTGGCTGGG - Intergenic
1068690298 10:59906851-59906873 TGGGCTTAGATCAGGGGGCTCGG - Intergenic
1069731335 10:70616872-70616894 TGGGCTTAGATCTCTGTGCTAGG - Intergenic
1069770163 10:70893564-70893586 GGGGCTTAGGACAGGGGGTTGGG - Intergenic
1072718261 10:97765697-97765719 TGTACCTAGAGCAGGGGGCTAGG - Intergenic
1073869837 10:107850586-107850608 TGGGCTGAGATGATGGGGATGGG - Intergenic
1073949019 10:108785332-108785354 TGGTCTTAGATAAGGGGGACTGG - Intergenic
1073969231 10:109028112-109028134 TGGGGTTATATCTGGGGACTTGG + Intergenic
1073988664 10:109238941-109238963 TGAGCTTGTATCAGGAGGCTAGG + Intergenic
1074593174 10:114833949-114833971 TGGGTTCAGATTAGGGGGCCAGG + Intronic
1077420818 11:2449063-2449085 TGGGCATGGATCAGGTGGCAGGG + Intronic
1077437770 11:2550979-2551001 TGTGCTGAGCTCAGTGGGCTTGG + Intronic
1077675714 11:4191708-4191730 TGGTTTTTGATCAGGGGACTGGG - Intergenic
1080929467 11:36793494-36793516 TGGGCTTACAGGAGAGGGCTGGG + Intergenic
1082789985 11:57340472-57340494 GGGACTCAGGTCAGGGGGCTGGG - Intronic
1083276000 11:61597514-61597536 TGGGATTAGATCAGAGAGCCAGG - Intergenic
1083647228 11:64179162-64179184 AGTGCTTGGATCAGTGGGCTGGG + Intergenic
1085514530 11:77104687-77104709 TGGCCTTAAGTCAGGGTGCTGGG - Intronic
1085644254 11:78213006-78213028 TGGGCTTTGACCAGTGGGATGGG + Intronic
1086920446 11:92580813-92580835 TAGGCTCAGATGAGGTGGCTGGG - Intronic
1088305682 11:108404861-108404883 TGGGATTCGATCAGGCTGCTGGG + Intronic
1091303922 11:134524486-134524508 TGGGCTTAGATCTGAGCCCTGGG - Intergenic
1091339482 11:134799302-134799324 TGGGATATGAGCAGGGGGCTGGG - Intergenic
1096132233 12:49168679-49168701 TGGGGTTAGAGTCGGGGGCTGGG + Intergenic
1096266580 12:50127733-50127755 TGGGCTTTGCACAGGTGGCTAGG - Intergenic
1096616187 12:52834675-52834697 TTGGCTTACAACAGGGGCCTGGG - Intergenic
1100761580 12:97813125-97813147 TGGGCTGAGCTCAGGTGGGTGGG - Intergenic
1100886495 12:99076634-99076656 TGGGATGACATCAGGAGGCTTGG + Intronic
1102956633 12:117063337-117063359 TGGGCTGAGGGCTGGGGGCTGGG - Intronic
1103531819 12:121607736-121607758 TGGTCATAGTTCTGGGGGCTGGG - Intergenic
1105604223 13:21913422-21913444 TGGGCTCAGGGCAGGGGCCTTGG - Intergenic
1106174798 13:27321015-27321037 AGGGCTGAGAGCAGGAGGCTGGG + Intergenic
1109192951 13:59346909-59346931 GGGGCTTAGATCAGGATGGTTGG + Intergenic
1111394676 13:87649756-87649778 TGGGCATAGATAAGGTGGATGGG - Intergenic
1112184445 13:97114516-97114538 TGGCCTCAGATCTAGGGGCTGGG - Intergenic
1112559729 13:100502276-100502298 TCTGCCTGGATCAGGGGGCTGGG - Intronic
1116586809 14:46716609-46716631 TGGGCTGGGGTCAGTGGGCTGGG - Intergenic
1120525092 14:85568228-85568250 TGGGGGAAGATCATGGGGCTTGG + Intronic
1120703876 14:87727473-87727495 TGGGCTTTGATCTGGGCACTGGG - Intergenic
1121617254 14:95320914-95320936 TGAGCTGGGAGCAGGGGGCTGGG - Intergenic
1122027036 14:98885706-98885728 TGGTCTTAGTGCTGGGGGCTGGG - Intergenic
1122885088 14:104707315-104707337 TGGGCCTTGACCAGGGGGCTCGG - Exonic
1125814872 15:42575647-42575669 TGGGCTTAGGGCGGGGGCCTGGG + Exonic
1127383356 15:58448345-58448367 TGAGCTAAGAAGAGGGGGCTGGG - Intronic
1128211779 15:65908468-65908490 TGGGCTGAAATCTGGTGGCTTGG - Intronic
1133575653 16:7086845-7086867 TGGGCTTAGTTGGTGGGGCTTGG + Intronic
1137382609 16:48012999-48013021 TGGGCTTAGCTTGGGGGGCAGGG + Intergenic
1138588196 16:57985131-57985153 GGGGCTTAGATGAGGAGGCGGGG + Intronic
1139012353 16:62648439-62648461 TGGCCCTAGTTCATGGGGCTTGG - Intergenic
1139484986 16:67250288-67250310 GGGGCTTGGATCTCGGGGCTGGG + Intronic
1139783084 16:69367934-69367956 TAGGCTGAGAGCATGGGGCTGGG - Intronic
1139847690 16:69932384-69932406 TGGGCCTGGAACAGGGGCCTGGG + Intronic
1141046911 16:80723543-80723565 TGGGATAAGATCAGTGTGCTGGG - Intronic
1141647797 16:85376761-85376783 TGGGCAGAGAGCAGGGGGCTGGG + Intergenic
1141692244 16:85602882-85602904 TGGTCTCAGGTCAGGGGTCTGGG + Intergenic
1142205933 16:88783216-88783238 TGGGCATTGGTCAGGGGGCCTGG - Intronic
1142880611 17:2880062-2880084 GGGGCTGGGAGCAGGGGGCTGGG + Intronic
1144019751 17:11229698-11229720 TGGACTTGGGTCAGGGGGCTGGG + Intergenic
1144728217 17:17512329-17512351 TGTGGTTAGAACAGGAGGCTGGG - Intronic
1144750929 17:17647458-17647480 TGGGCTCAAATCTGAGGGCTTGG + Intergenic
1147318571 17:39632724-39632746 TGGGCTGGGAGCTGGGGGCTGGG + Intronic
1147565004 17:41530560-41530582 TGGTCTTAGAGTAGGGGGCTGGG - Intergenic
1148818775 17:50348275-50348297 TTGGCTTAGATCAGGGGGTCAGG + Intronic
1149328320 17:55555835-55555857 AGAGCTTAGAGCAGGGGGGTGGG - Intergenic
1149496645 17:57122495-57122517 TGGGCTTTGATGAGTGGGATGGG + Intergenic
1149752545 17:59159795-59159817 TGAGCTTTGATGAAGGGGCTAGG - Intronic
1151047264 17:70936109-70936131 TGGGCTTAGCCTAGGGGCCTAGG - Intergenic
1151384236 17:73745447-73745469 GGGGCTGAGCTCAAGGGGCTGGG - Intergenic
1152186140 17:78857402-78857424 TGGTCTTAGATCAGGAGCCGGGG + Intronic
1153493278 18:5671537-5671559 TGGGCTTAGGTCAGGGGACGGGG + Intergenic
1153940461 18:9972511-9972533 TGGGGTTAGACCAAGGGGCCAGG + Intergenic
1156185700 18:34660692-34660714 TGGGCTAAGATAAGGGGTTTTGG - Intronic
1158696444 18:59708309-59708331 TGGGCTAAAATCAAGGTGCTGGG + Intergenic
1163939196 19:20477201-20477223 TGGGCTTACCTGAGGGGGCATGG + Intergenic
1164733766 19:30525620-30525642 TGGGCTGAGAGCTGGGGGTTGGG + Intronic
1165104413 19:33460589-33460611 AGAGCTTAGAGCAGGGGGGTGGG - Intronic
1165435003 19:35790678-35790700 TGGGTGTAGTTCAGGGGGCGGGG + Intergenic
1166746168 19:45142847-45142869 TGGGCTTCCATCCGGAGGCTGGG + Intronic
1167649912 19:50723572-50723594 TGGGCTTTGGCCATGGGGCTCGG + Exonic
1168129067 19:54305828-54305850 TGGGCTGAAGTCAGAGGGCTTGG + Intergenic
925282089 2:2691707-2691729 TGGGATTAGACCAGAGGGCAGGG + Intergenic
927279774 2:21294354-21294376 TGTGCTTAGAGCTGGGGGCTGGG - Intergenic
933981773 2:87556314-87556336 TGGGCCTAGATCAGGGCACCAGG + Intergenic
934618603 2:95790760-95790782 TGGGGTTAGATTTGGGGGTTGGG + Intergenic
934642290 2:96033797-96033819 TGGGGTTAGATTTGGGGGTTGGG - Intronic
935754135 2:106264025-106264047 TGAGCTTAGATGAGGGGGGAAGG + Intergenic
935864806 2:107375675-107375697 TGGGCGTGGATCAGGCAGCTAGG - Intergenic
936312063 2:111394503-111394525 TGGGCCTAGATCAGGGCACCAGG - Intergenic
936452377 2:112643319-112643341 AGGGCTTGGATCAGAGGGCAGGG + Intergenic
937295406 2:120807082-120807104 TGCACTCAGATCAGGGGGCTGGG + Intronic
937305721 2:120869246-120869268 AGGGCTGTGGTCAGGGGGCTGGG + Intronic
938277258 2:130037727-130037749 TGGGCTTTGACCAGGTGGCTGGG - Intergenic
938328225 2:130428532-130428554 TGGGCTTTGACCAGGCGGCTGGG - Intergenic
938361722 2:130692962-130692984 TGGGCTTTGACCAGGCGGCTGGG + Intergenic
938438127 2:131299645-131299667 TGGGCTTTGACCAGGTGGCTGGG + Intronic
939660791 2:144887065-144887087 TTGGCTTAGATCTTGGGCCTTGG + Intergenic
946388993 2:219404436-219404458 TGGGCTTGGAAATGGGGGCTCGG + Intergenic
947739913 2:232480334-232480356 TGGGGTGGGATCAGGGGGCATGG - Intronic
947903915 2:233745771-233745793 TGAGCTTAGACAGGGGGGCTGGG + Intronic
948409079 2:237745105-237745127 AGGGCTTAGGAAAGGGGGCTTGG + Intronic
1168860489 20:1043051-1043073 TGGTCTTAGATCATGTGGTTGGG - Intergenic
1170871013 20:20206429-20206451 AGGGCTGAGAGCAGAGGGCTGGG - Intronic
1172897301 20:38309445-38309467 TGGGCTTAGCAGAGGAGGCTTGG + Intronic
1175478157 20:59291716-59291738 TGGGCTTAGAACATAGGGATTGG + Intergenic
1178377150 21:32076351-32076373 TGGGCTTAGCTCAAGCGGCCTGG - Intergenic
1181056795 22:20264060-20264082 TGGGCTGATTTCAGGGGACTCGG - Intronic
1181462627 22:23094548-23094570 TGGGCTGAGACCAAGGAGCTGGG - Intronic
1181587568 22:23861895-23861917 TGGACTCAGAACAGGAGGCTTGG + Intronic
1182062275 22:27406788-27406810 TGGGCTGCCATCAGGGGTCTGGG + Intergenic
1182183039 22:28371635-28371657 TGAGCTGAGATCAGTGGCCTGGG - Intronic
1182622428 22:31625463-31625485 TGGGCTGCGAGCAGGGGGCCTGG + Intronic
1185344090 22:50303947-50303969 TGGGCTGGGATCAGGGCGCCTGG - Intronic
950713648 3:14832081-14832103 GGGGCTCAGATCAGAGGGCGGGG - Intronic
952386690 3:32846663-32846685 TGGGGTTGGAGCGGGGGGCTGGG - Intronic
952749576 3:36814431-36814453 AGGGCTTAGCTCAGGTGGCCTGG + Intergenic
953002744 3:38950483-38950505 TGAGCTGAGGTCAGGGGCCTTGG + Exonic
955406721 3:58630428-58630450 TGGCCTCAGAACTGGGGGCTTGG - Intergenic
960333848 3:116392658-116392680 GGGTCTGAAATCAGGGGGCTGGG + Intronic
961318218 3:126055034-126055056 TGAGCTCAGATTAGGAGGCTGGG + Intronic
961534189 3:127559518-127559540 TGGGCATAGGTAAGGGGCCTGGG - Intergenic
963523200 3:146381526-146381548 TGTGCTTAGACCATGGGACTGGG + Intergenic
963598346 3:147356406-147356428 GGGGCCCAGATCTGGGGGCTGGG - Intergenic
966867484 3:184267206-184267228 TGGGCTTCCATCAGGTGGATAGG - Intronic
968720333 4:2197852-2197874 TGGCCTTAAATCAGAGGGCTGGG + Intronic
968746157 4:2361694-2361716 TGGGCTGAGATCTGGCGCCTTGG - Intronic
968763955 4:2458578-2458600 TGGGCTTAGACCTGGGTTCTGGG + Intronic
969580353 4:8061194-8061216 TGGGCTCTGCTCAGGGGTCTTGG - Intronic
977425377 4:96861977-96861999 TGTGCTCAGTTAAGGGGGCTTGG - Intergenic
979504520 4:121480289-121480311 TGGGCTTAGACAAGTGGACTGGG - Intergenic
981579475 4:146237522-146237544 TGAGCTTAAATCAGAGGGCTTGG - Intergenic
982482815 4:155933054-155933076 TGGCCTTAGAGCAGGGTGTTAGG - Intronic
990466876 5:56078997-56079019 TGTGTTTAGATCAGAGGACTTGG + Intergenic
990492858 5:56319392-56319414 CGGACTGAGATCTGGGGGCTGGG - Intergenic
991655824 5:68902831-68902853 TGGGCTTAGAGCAGAGTGGTGGG + Intergenic
992640844 5:78767237-78767259 TGTGCTTGGATCAGAGGGCAAGG + Intronic
994202979 5:97000024-97000046 TGGGGTTATATCAGGGGACAAGG + Intronic
997367960 5:133337976-133337998 TGGCCTTAGATGAGGGGGTTTGG + Intronic
998476794 5:142428829-142428851 TGAGAGAAGATCAGGGGGCTTGG - Intergenic
998564150 5:143201226-143201248 TGGGCCTAGATGTGGGGGCCTGG + Intronic
1000187754 5:158877143-158877165 TGGGCTTGGAACTGTGGGCTTGG - Intronic
1001506675 5:172284729-172284751 TGACCTTAGTTCAGGGGGCGTGG + Intergenic
1004159584 6:13201561-13201583 TGGGGACAGATCAGAGGGCTGGG + Intronic
1006459375 6:34149518-34149540 TGGGCTGAGGTCAAGGGGCTAGG + Intronic
1006962206 6:37944727-37944749 TGGGCTGATACCAGTGGGCTGGG + Intronic
1009452712 6:63819915-63819937 TGGGATTATATCAGGGGTCCGGG + Intronic
1013626708 6:111945256-111945278 TGGGCTTAGATAAGGAGTCTAGG - Intergenic
1016871978 6:148826708-148826730 TGGGCTAAAATCAAGGGGCCAGG + Intronic
1017882057 6:158568795-158568817 TGGTCTCACAGCAGGGGGCTAGG + Intronic
1019315376 7:381701-381723 GGGGCCTTGAGCAGGGGGCTCGG + Intergenic
1019595742 7:1857571-1857593 GGGGCTCAGGTGAGGGGGCTGGG + Intronic
1020491115 7:8785516-8785538 TGGGTTAAAAGCAGGGGGCTAGG + Intergenic
1020743798 7:12055581-12055603 TGGGCATAGAGCTGGGGTCTGGG - Intergenic
1021653932 7:22856150-22856172 GAGGCTGAGTTCAGGGGGCTGGG - Intergenic
1021714590 7:23449858-23449880 TGAAATTAGATCAGGTGGCTGGG - Intronic
1022022636 7:26415611-26415633 TGGGCTTGAATCAGGCAGCTGGG - Intergenic
1027536137 7:79404655-79404677 TGGGCCTAGCTCAGGGGCCTGGG - Intronic
1035287490 7:157815490-157815512 TGGGCTGAGCTCAGGGTGCTGGG + Intronic
1035974667 8:4294979-4295001 TGGGTTCAGATCAGGTGACTTGG - Intronic
1037319384 8:17629419-17629441 TGGGTTTAGACCAAGAGGCTGGG - Intronic
1037895816 8:22654007-22654029 AGGGCTGAGATCAGGGTGATTGG - Intronic
1045320325 8:101077397-101077419 TGGATTTATATCATGGGGCTAGG + Intergenic
1046463373 8:114570957-114570979 TGGACCCAGAGCAGGGGGCTTGG - Intergenic
1048479834 8:134778917-134778939 TGGGCTTAACTCAGTGGTCTTGG + Intergenic
1049257364 8:141621085-141621107 TGGGGTCAGATCATGGGGCACGG + Intergenic
1049373390 8:142278181-142278203 TGGGCTTGGACAAGGGGCCTGGG - Intronic
1049791320 8:144473951-144473973 TGGGCTGAGAAGAGGGGACTAGG + Exonic
1050703268 9:8365480-8365502 TGGGGTCAGCTTAGGGGGCTTGG + Intronic
1051464979 9:17367458-17367480 TGGGCTCAGACCAGTGGACTTGG + Intronic
1059507703 9:114814662-114814684 TGGTCTTAGTTCTGGAGGCTGGG + Intergenic
1060663222 9:125416481-125416503 GGGGCTTGGCTCAGGGGGCCTGG - Intergenic
1060864143 9:126981474-126981496 AGGGATTAGGTCAGAGGGCTAGG - Intronic
1061571054 9:131477641-131477663 TGGGCCTAGATCAGGGTGCCGGG + Intronic
1061892312 9:133629358-133629380 TTGGCTGAGAACAGGGGACTTGG - Intergenic
1061911326 9:133726700-133726722 TGGGCTGAGGTCAGGAGGCAGGG - Intronic
1062064905 9:134521579-134521601 GGGACTGGGATCAGGGGGCTAGG - Intergenic
1062391465 9:136335653-136335675 TGGGCCTGGGGCAGGGGGCTGGG - Intronic
1062682029 9:137787378-137787400 TGGGCTGAGAAGAGGGGACTAGG + Intronic
1189579788 X:42394007-42394029 AGGGCTGAGGTCTGGGGGCTTGG + Intergenic
1189637466 X:43026666-43026688 TGAGATTAGTTCAGGGTGCTTGG + Intergenic
1189848314 X:45156403-45156425 TGGGATGAGAGCATGGGGCTGGG - Intronic
1190166242 X:48075035-48075057 TGGGCCTAGATGAGGGGTCCAGG + Intergenic
1193956415 X:87869329-87869351 TGGGCTGAGATCAGAAGCCTAGG + Intergenic
1196098482 X:111824563-111824585 TGGGCCTAGAGGAGGGGCCTGGG + Intronic
1196865909 X:120070811-120070833 TGGGACTAGTTCAAGGGGCTGGG - Intergenic
1196877187 X:120165469-120165491 TGGGACTAGTTCAAGGGGCTGGG + Intergenic
1198480306 X:137034260-137034282 TGGCCCGAAATCAGGGGGCTAGG - Intergenic
1199606768 X:149584784-149584806 TGTTCTTAGATCTGGGGGCGGGG - Intronic
1199632355 X:149784584-149784606 TGTTCTTAGATCTGGGGGCGGGG + Intronic