ID: 1068690299

View in Genome Browser
Species Human (GRCh38)
Location 10:59906854-59906876
Sequence AGCCCCCTGATCTAAGCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 181}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690286_1068690299 26 Left 1068690286 10:59906805-59906827 CCCGCACCACCAGCTCGCCAGCC 0: 1
1: 0
2: 2
3: 28
4: 460
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690284_1068690299 28 Left 1068690284 10:59906803-59906825 CCCCCGCACCACCAGCTCGCCAG 0: 1
1: 0
2: 1
3: 12
4: 205
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690285_1068690299 27 Left 1068690285 10:59906804-59906826 CCCCGCACCACCAGCTCGCCAGC 0: 1
1: 0
2: 0
3: 13
4: 182
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690295_1068690299 5 Left 1068690295 10:59906826-59906848 CCACACGTGTTCCAAGGGAGGGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690296_1068690299 -6 Left 1068690296 10:59906837-59906859 CCAAGGGAGGGCCTCCGAGCCCC 0: 1
1: 0
2: 4
3: 22
4: 279
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690289_1068690299 17 Left 1068690289 10:59906814-59906836 CCAGCTCGCCAGCCACACGTGTT 0: 1
1: 0
2: 1
3: 2
4: 55
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690288_1068690299 20 Left 1068690288 10:59906811-59906833 CCACCAGCTCGCCAGCCACACGT 0: 1
1: 0
2: 1
3: 15
4: 146
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690292_1068690299 9 Left 1068690292 10:59906822-59906844 CCAGCCACACGTGTTCCAAGGGA 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181
1068690287_1068690299 25 Left 1068690287 10:59906806-59906828 CCGCACCACCAGCTCGCCAGCCA 0: 1
1: 0
2: 0
3: 35
4: 316
Right 1068690299 10:59906854-59906876 AGCCCCCTGATCTAAGCCCACGG 0: 1
1: 0
2: 0
3: 11
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690299 Original CRISPR AGCCCCCTGATCTAAGCCCA CGG Intergenic