ID: 1068690300 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:59906856-59906878 |
Sequence | GGCCGTGGGCTTAGATCAGG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 99 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 10, 4: 88} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1068690300_1068690306 | -7 | Left | 1068690300 | 10:59906856-59906878 | CCCCCTGATCTAAGCCCACGGCC | 0: 1 1: 0 2: 0 3: 10 4: 88 |
||
Right | 1068690306 | 10:59906872-59906894 | CACGGCCGCCCAGCCTCTTCCGG | No data | ||||
1068690300_1068690307 | -6 | Left | 1068690300 | 10:59906856-59906878 | CCCCCTGATCTAAGCCCACGGCC | 0: 1 1: 0 2: 0 3: 10 4: 88 |
||
Right | 1068690307 | 10:59906873-59906895 | ACGGCCGCCCAGCCTCTTCCGGG | No data | ||||
1068690300_1068690313 | 18 | Left | 1068690300 | 10:59906856-59906878 | CCCCCTGATCTAAGCCCACGGCC | 0: 1 1: 0 2: 0 3: 10 4: 88 |
||
Right | 1068690313 | 10:59906897-59906919 | TCGCGCCCGCCCCGAGAAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1068690300 | Original CRISPR | GGCCGTGGGCTTAGATCAGG GGG (reversed) | Intergenic | ||