ID: 1068690300

View in Genome Browser
Species Human (GRCh38)
Location 10:59906856-59906878
Sequence GGCCGTGGGCTTAGATCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690300_1068690313 18 Left 1068690300 10:59906856-59906878 CCCCCTGATCTAAGCCCACGGCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690300_1068690307 -6 Left 1068690300 10:59906856-59906878 CCCCCTGATCTAAGCCCACGGCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690300_1068690306 -7 Left 1068690300 10:59906856-59906878 CCCCCTGATCTAAGCCCACGGCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690300 Original CRISPR GGCCGTGGGCTTAGATCAGG GGG (reversed) Intergenic