ID: 1068690300

View in Genome Browser
Species Human (GRCh38)
Location 10:59906856-59906878
Sequence GGCCGTGGGCTTAGATCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690300_1068690306 -7 Left 1068690300 10:59906856-59906878 CCCCCTGATCTAAGCCCACGGCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data
1068690300_1068690307 -6 Left 1068690300 10:59906856-59906878 CCCCCTGATCTAAGCCCACGGCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690300_1068690313 18 Left 1068690300 10:59906856-59906878 CCCCCTGATCTAAGCCCACGGCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690300 Original CRISPR GGCCGTGGGCTTAGATCAGG GGG (reversed) Intergenic
900331431 1:2136604-2136626 GGCTGTGTGCTTAGGGCAGGTGG + Intronic
900715379 1:4140640-4140662 TGCTGTGGGCTTGGATCAGGGGG - Intergenic
900984757 1:6066781-6066803 GGCCCTGGGCCTGGCTCAGGTGG - Intronic
902496628 1:16876615-16876637 GGCCGAGGTGGTAGATCAGGAGG + Intronic
904744023 1:32700120-32700142 CACCGTGGGCTTAGAGTAGGAGG - Intronic
904837491 1:33348906-33348928 GGCCCAGGGCTTAGTTCAGATGG + Intronic
916687692 1:167162086-167162108 GGCCTTGGGTTAAGATGAGGAGG - Intergenic
919889092 1:201957267-201957289 CGCCATGGGCTAAGAACAGGGGG - Exonic
922157677 1:223052796-223052818 GGCTGTGGGCTTTGATCCTGGGG + Intergenic
922996283 1:229964345-229964367 GGCCCTGGGCATAGAACTGGAGG - Intergenic
1064457859 10:15505250-15505272 GGCCAAGGGCTTAGATAAAGGGG + Intergenic
1065555248 10:26908651-26908673 GGCCTGGTGCTGAGATCAGGAGG + Intergenic
1065595605 10:27308155-27308177 GGCCTGGTGCTGAGATCAGGAGG - Intergenic
1066285642 10:33963416-33963438 GGCCCTAGCCTTATATCAGGTGG - Intergenic
1068690300 10:59906856-59906878 GGCCGTGGGCTTAGATCAGGGGG - Intergenic
1069589577 10:69633441-69633463 GGACTTGGGCTTAGGGCAGGTGG + Exonic
1073949020 10:108785337-108785359 GGAGGTGGTCTTAGATAAGGGGG - Intergenic
1076536802 10:131183695-131183717 GGCCCTGAGCTCAGATGAGGGGG - Intronic
1077541116 11:3146979-3147001 GGCTGTGCGTTTAGCTCAGGAGG - Intronic
1089081161 11:115777180-115777202 GGCAGTAGGCTTACATCAGCAGG - Intergenic
1092617370 12:10227536-10227558 GGCAGTGGGCATAGGTGAGGAGG - Intergenic
1096848741 12:54421800-54421822 GGCAGTGGGCTTAGAGGAGAAGG - Intergenic
1101159395 12:101958149-101958171 GGCCCTTGGCTGGGATCAGGAGG + Intronic
1107679405 13:42832773-42832795 GGCCGCGGCGTTATATCAGGAGG - Intergenic
1108636962 13:52344634-52344656 TGCAGTGAGCTGAGATCAGGTGG + Intergenic
1111394678 13:87649761-87649783 GGCACTGGGCATAGATAAGGTGG - Intergenic
1115420001 14:33183512-33183534 AGCCCTGGGCTTAGATTAGATGG - Intronic
1115754578 14:36518938-36518960 GGCCGCGGGCTGAGCTCAGGAGG - Intronic
1117105578 14:52394551-52394573 GGCCGTGGGCAGATATGAGGGGG - Intergenic
1118172220 14:63398555-63398577 GGCCGAGGGGGTAGATCACGAGG + Intronic
1121559023 14:94860767-94860789 GGGCGGGGGCTGAGATCAGGGGG - Intergenic
1126013581 15:44327714-44327736 GTCTGTAGGCTTAGATCATGAGG + Intronic
1133730962 16:8578146-8578168 GGCCTTGTTCTTAGATCAGGTGG + Intronic
1136515425 16:30765309-30765331 GGCAGAGGCCTTAGAGCAGGTGG + Exonic
1139692186 16:68648257-68648279 GGCCCTGGGCATATACCAGGAGG - Intronic
1146905708 17:36616610-36616632 AGCCGTGTGCTTGGAACAGGAGG + Intergenic
1147322912 17:39656835-39656857 GGCCGTGGGCTGAGATCCCTTGG + Intronic
1148818774 17:50348270-50348292 AGGGGTTGGCTTAGATCAGGGGG + Intronic
1152217987 17:79045529-79045551 GGCCCTGGGCTCAGTTCTGGAGG + Intronic
1154446029 18:14436577-14436599 GGCCGAGGGCATGGATCACGAGG - Intergenic
1156943152 18:42795311-42795333 GGGCGTGGGCTTGGAACAGACGG + Intronic
1157258416 18:46158226-46158248 TGCAGTGAGCTGAGATCAGGTGG + Intergenic
1158323961 18:56294410-56294432 GGACGTGGGCTTGCAGCAGGAGG - Intergenic
1161064718 19:2231990-2232012 GGCCCAGGGCTCAGAACAGGAGG - Exonic
1161096799 19:2396710-2396732 GGCCGGGGGCTTTGACCTGGAGG + Intronic
1161703363 19:5806362-5806384 GGCCAGGGGCTTAAAGCAGGGGG + Intergenic
1165140732 19:33698580-33698602 GGCAGTGGTCTTGGTTCAGGGGG + Intronic
1166352863 19:42208564-42208586 GGCAGTGGGTTTTGAGCAGGAGG - Intronic
1167136266 19:47618004-47618026 GGGAGTGGGCTTTGATCAGGTGG + Intronic
1167664936 19:50818449-50818471 GGGCGTGGCCTGATATCAGGGGG - Intergenic
1168407915 19:56120561-56120583 GCGCGTGGCCTTTGATCAGGCGG - Intronic
927250103 2:20989414-20989436 GGCAGTTGGCTTAGAGAAGGGGG + Intergenic
932251915 2:70252184-70252206 TGCAGTGAGCTGAGATCAGGCGG - Intergenic
932863885 2:75321536-75321558 GGCCTTGGGGTGGGATCAGGTGG + Intergenic
937238690 2:120446501-120446523 GGCTGTGGCCTTGGATGAGGTGG - Intergenic
940921849 2:159316455-159316477 GGCCGTGGGGGCAGATCACGAGG + Intergenic
948666529 2:239538173-239538195 GGCCGTCGGCTCAGAGCAGGAGG + Intergenic
949045100 2:241869045-241869067 GGCCGCGGGCTGAGATCGGGAGG + Intergenic
1175658157 20:60789948-60789970 GGCCATGGGCTTAGCTGAGTTGG - Intergenic
1176300106 21:5095343-5095365 GGCCGTGGGGTCAGGCCAGGAGG + Intergenic
1178377151 21:32076356-32076378 GGAAGTGGGCTTAGCTCAAGCGG - Intergenic
1179856916 21:44166568-44166590 GGCCGTGGGGTCAGGCCAGGAGG - Intergenic
1180633163 22:17243852-17243874 GGCTGTGGGGTCCGATCAGGTGG - Intergenic
1181627962 22:24134127-24134149 GGCCATGGGCTTTGATCATCAGG - Intronic
1182582975 22:31326337-31326359 GGCAGAGGGCTGAGCTCAGGGGG + Exonic
1182620572 22:31616414-31616436 GGTCATGAGCTTAGAGCAGGTGG + Intronic
1182935480 22:34217790-34217812 TGCAGTGAGCTGAGATCAGGAGG + Intergenic
1182935482 22:34217814-34217836 TGCAGTGAGCTGAGATCAGGAGG + Intergenic
1183441845 22:37827479-37827501 GACAGAGGGCTCAGATCAGGAGG - Intergenic
1184697376 22:46147620-46147642 GGCCGTGGGCTGAGAAAGGGAGG - Intergenic
953410044 3:42685621-42685643 GGCGCTGGGCTTGGAGCAGGCGG + Exonic
953906114 3:46869019-46869041 GGCCTGGGGCTTGGGTCAGGAGG + Intronic
955443872 3:58986404-58986426 GGCCTTGGGCTTAAATAAGGTGG + Intronic
960155529 3:114294076-114294098 GCCCCTGGGCCCAGATCAGGAGG - Exonic
962422580 3:135241369-135241391 GGCCGTGAGCTGAAAACAGGAGG - Intronic
965631177 3:170734480-170734502 GGCCCTGGGTTTAGCTCAGGGGG - Intronic
967037256 3:185657228-185657250 GGCCGTGGGATGAGAGGAGGTGG + Intronic
974605159 4:64142463-64142485 AGCTGAGGCCTTAGATCAGGTGG - Intergenic
979515442 4:121603881-121603903 GGGCATGGGATAAGATCAGGGGG - Intergenic
984425711 4:179582652-179582674 GGCATTGGGCTTAGAACAGAAGG - Intergenic
985133283 4:186760207-186760229 GGCTGTGGGGTTAGCTCAGAGGG + Intergenic
985904023 5:2819036-2819058 GGCAGTGGGCCTGGTTCAGGTGG + Intergenic
990613117 5:57479191-57479213 GGCCCTGGGCTCAGAGCAGTGGG - Intergenic
1006582833 6:35086665-35086687 GGTCTGGGGCTTAGAGCAGGAGG + Intronic
1007600589 6:43078304-43078326 GGCTGAGGGCTTAGGACAGGAGG + Intronic
1008626846 6:53325587-53325609 GGCTGAGGGCTTTGCTCAGGAGG + Intronic
1022511695 7:30938809-30938831 GGCCGGGGGCTTGGAGCTGGTGG - Intronic
1027256731 7:76435495-76435517 GGCGGTGAGCTTAGAATAGGTGG + Intronic
1027282121 7:76616512-76616534 GGCCGTGAGCTTAGAATAGGTGG - Intronic
1027606017 7:80299680-80299702 GGCCGTGGCCTTAGATGAAAAGG - Intergenic
1047387707 8:124425369-124425391 GGCCTTGGGCTTAGTCCAGAAGG - Intergenic
1048853786 8:138669323-138669345 GGCCGTGGGGTCTGATAAGGAGG + Intronic
1049106260 8:140615391-140615413 GGCCCGGGGCCTAGAGCAGGTGG - Intronic
1049598948 8:143498396-143498418 GGCTGTGGACTCAGGTCAGGGGG - Intronic
1050296338 9:4209159-4209181 GGGGGTTGGGTTAGATCAGGGGG - Intronic
1051130332 9:13853116-13853138 GGCTGAGGCCTGAGATCAGGAGG + Intergenic
1060876854 9:127089995-127090017 GGCCGTGGGATGAGGTGAGGAGG + Intronic
1189256488 X:39643767-39643789 AGCCCTGGGCTGAGGTCAGGAGG + Intergenic
1198959452 X:142168960-142168982 AACCCTGGGCTTAGAACAGGAGG + Intergenic