ID: 1068690303

View in Genome Browser
Species Human (GRCh38)
Location 10:59906859-59906881
Sequence GGCGGCCGTGGGCTTAGATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690303_1068690307 -9 Left 1068690303 10:59906859-59906881 CCTGATCTAAGCCCACGGCCGCC No data
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690303_1068690313 15 Left 1068690303 10:59906859-59906881 CCTGATCTAAGCCCACGGCCGCC No data
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690303_1068690306 -10 Left 1068690303 10:59906859-59906881 CCTGATCTAAGCCCACGGCCGCC No data
Right 1068690306 10:59906872-59906894 CACGGCCGCCCAGCCTCTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690303 Original CRISPR GGCGGCCGTGGGCTTAGATC AGG (reversed) Intergenic