ID: 1068690307

View in Genome Browser
Species Human (GRCh38)
Location 10:59906873-59906895
Sequence ACGGCCGCCCAGCCTCTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690301_1068690307 -7 Left 1068690301 10:59906857-59906879 CCCCTGATCTAAGCCCACGGCCG No data
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690295_1068690307 24 Left 1068690295 10:59906826-59906848 CCACACGTGTTCCAAGGGAGGGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690298_1068690307 -1 Left 1068690298 10:59906851-59906873 CCGAGCCCCCTGATCTAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 184
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690297_1068690307 2 Left 1068690297 10:59906848-59906870 CCTCCGAGCCCCCTGATCTAAGC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690303_1068690307 -9 Left 1068690303 10:59906859-59906881 CCTGATCTAAGCCCACGGCCGCC No data
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690292_1068690307 28 Left 1068690292 10:59906822-59906844 CCAGCCACACGTGTTCCAAGGGA 0: 1
1: 0
2: 0
3: 7
4: 64
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690302_1068690307 -8 Left 1068690302 10:59906858-59906880 CCCTGATCTAAGCCCACGGCCGC No data
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690296_1068690307 13 Left 1068690296 10:59906837-59906859 CCAAGGGAGGGCCTCCGAGCCCC 0: 1
1: 0
2: 4
3: 22
4: 279
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data
1068690300_1068690307 -6 Left 1068690300 10:59906856-59906878 CCCCCTGATCTAAGCCCACGGCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1068690307 10:59906873-59906895 ACGGCCGCCCAGCCTCTTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690307 Original CRISPR ACGGCCGCCCAGCCTCTTCC GGG Intergenic
No off target data available for this crispr