ID: 1068690313

View in Genome Browser
Species Human (GRCh38)
Location 10:59906897-59906919
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068690310_1068690313 -7 Left 1068690310 10:59906881-59906903 CCAGCCTCTTCCGGGCTCGCGCC No data
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690301_1068690313 17 Left 1068690301 10:59906857-59906879 CCCCTGATCTAAGCCCACGGCCG No data
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690305_1068690313 3 Left 1068690305 10:59906871-59906893 CCACGGCCGCCCAGCCTCTTCCG No data
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690300_1068690313 18 Left 1068690300 10:59906856-59906878 CCCCCTGATCTAAGCCCACGGCC 0: 1
1: 0
2: 0
3: 10
4: 88
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690302_1068690313 16 Left 1068690302 10:59906858-59906880 CCCTGATCTAAGCCCACGGCCGC No data
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690297_1068690313 26 Left 1068690297 10:59906848-59906870 CCTCCGAGCCCCCTGATCTAAGC 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690308_1068690313 -3 Left 1068690308 10:59906877-59906899 CCGCCCAGCCTCTTCCGGGCTCG No data
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690298_1068690313 23 Left 1068690298 10:59906851-59906873 CCGAGCCCCCTGATCTAAGCCCA 0: 1
1: 0
2: 0
3: 22
4: 184
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690309_1068690313 -6 Left 1068690309 10:59906880-59906902 CCCAGCCTCTTCCGGGCTCGCGC No data
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690304_1068690313 4 Left 1068690304 10:59906870-59906892 CCCACGGCCGCCCAGCCTCTTCC No data
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data
1068690303_1068690313 15 Left 1068690303 10:59906859-59906881 CCTGATCTAAGCCCACGGCCGCC No data
Right 1068690313 10:59906897-59906919 TCGCGCCCGCCCCGAGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068690313 Original CRISPR TCGCGCCCGCCCCGAGAAAA AGG Intergenic