ID: 1068693789

View in Genome Browser
Species Human (GRCh38)
Location 10:59944326-59944348
Sequence CACTGTCAAGGGATGGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068693777_1068693789 21 Left 1068693777 10:59944282-59944304 CCAAGGGAGTCCAAGGAGGGGCT No data
Right 1068693789 10:59944326-59944348 CACTGTCAAGGGATGGAGCTTGG No data
1068693779_1068693789 11 Left 1068693779 10:59944292-59944314 CCAAGGAGGGGCTTAGGTGATGC No data
Right 1068693789 10:59944326-59944348 CACTGTCAAGGGATGGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068693789 Original CRISPR CACTGTCAAGGGATGGAGCT TGG Intergenic
No off target data available for this crispr