ID: 1068700044

View in Genome Browser
Species Human (GRCh38)
Location 10:60009930-60009952
Sequence GTAGCATCCTAGAGCGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068700040_1068700044 -2 Left 1068700040 10:60009909-60009931 CCCAGGCCTCTGCAGCAGCCTGT No data
Right 1068700044 10:60009930-60009952 GTAGCATCCTAGAGCGTGAAAGG No data
1068700042_1068700044 -8 Left 1068700042 10:60009915-60009937 CCTCTGCAGCAGCCTGTAGCATC No data
Right 1068700044 10:60009930-60009952 GTAGCATCCTAGAGCGTGAAAGG No data
1068700039_1068700044 -1 Left 1068700039 10:60009908-60009930 CCCCAGGCCTCTGCAGCAGCCTG No data
Right 1068700044 10:60009930-60009952 GTAGCATCCTAGAGCGTGAAAGG No data
1068700038_1068700044 12 Left 1068700038 10:60009895-60009917 CCAGAGTGGGTGTCCCCAGGCCT No data
Right 1068700044 10:60009930-60009952 GTAGCATCCTAGAGCGTGAAAGG No data
1068700041_1068700044 -3 Left 1068700041 10:60009910-60009932 CCAGGCCTCTGCAGCAGCCTGTA No data
Right 1068700044 10:60009930-60009952 GTAGCATCCTAGAGCGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068700044 Original CRISPR GTAGCATCCTAGAGCGTGAA AGG Intergenic
No off target data available for this crispr