ID: 1068700652

View in Genome Browser
Species Human (GRCh38)
Location 10:60016156-60016178
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068700650_1068700652 -1 Left 1068700650 10:60016134-60016156 CCTATATTTATAAATTAGATACT No data
Right 1068700652 10:60016156-60016178 TAGAAGACTTGAATGTGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068700652 Original CRISPR TAGAAGACTTGAATGTGGAG AGG Intergenic
No off target data available for this crispr