ID: 1068701694

View in Genome Browser
Species Human (GRCh38)
Location 10:60026666-60026688
Sequence CCTTATTTACAGAGGAAAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 236}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068701688_1068701694 15 Left 1068701688 10:60026628-60026650 CCAAATGAACAGCGAGGAACATC 0: 1
1: 0
2: 0
3: 5
4: 75
Right 1068701694 10:60026666-60026688 CCTTATTTACAGAGGAAAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 236
1068701686_1068701694 26 Left 1068701686 10:60026617-60026639 CCAGGATGATACCAAATGAACAG 0: 1
1: 0
2: 1
3: 7
4: 111
Right 1068701694 10:60026666-60026688 CCTTATTTACAGAGGAAAGGAGG 0: 1
1: 0
2: 1
3: 24
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068701694 Original CRISPR CCTTATTTACAGAGGAAAGG AGG Exonic
900845031 1:5090955-5090977 CCTGATTTTCAGATAAAAGGTGG - Intergenic
900909069 1:5581525-5581547 CCTTATAAAAAGAGGAAACGTGG + Intergenic
901405630 1:9043378-9043400 CCTCATTTGCAGAGCAAAGAGGG + Intronic
902417385 1:16248664-16248686 CCTTATTTACAAGGGAAAGCTGG - Exonic
902523648 1:17038932-17038954 CCATATTAACAGAATAAAGGGGG - Intronic
904160735 1:28520410-28520432 CCTTATTTATTGAAGAAAGTGGG - Intronic
905150592 1:35923833-35923855 TCTTCTTTACAGAGGAAAATAGG + Exonic
907731160 1:57067346-57067368 CTTTATTTACAGAGGTCAGAGGG + Intronic
907858278 1:58325396-58325418 CCTGGTTTAGAGAGGTAAGGAGG - Intronic
908080560 1:60573635-60573657 CCTTATTTAGAGTGTACAGGGGG - Intergenic
909694661 1:78453384-78453406 GCTAACCTACAGAGGAAAGGTGG - Intronic
913439876 1:118886022-118886044 CCCTAATCACAGAGGAAATGGGG + Intronic
915980369 1:160416403-160416425 CCTTATCTCCAGAGGAGTGGGGG + Intronic
920118795 1:203639927-203639949 CCCTATTTTCAGAGGCAATGTGG + Intronic
920718953 1:208368950-208368972 CCATACTTACAGAGGTAGGGAGG + Intergenic
922296817 1:224257238-224257260 GCTTATCAACAGATGAAAGGAGG - Intronic
922376113 1:224969017-224969039 CATAAGTTACAGAGGAAATGGGG - Intronic
923651158 1:235875299-235875321 CCTTAGTTAAAAATGAAAGGAGG - Intronic
923900788 1:238324021-238324043 GCCTGTGTACAGAGGAAAGGAGG - Intergenic
924173542 1:241366097-241366119 CCATATTTAAAGAGGAAACGAGG - Intergenic
1062859137 10:796333-796355 GTTAATTTATAGAGGAAAGGAGG - Intergenic
1063468093 10:6261521-6261543 CCTTGTTGACAGAGGAGAGTGGG + Intergenic
1063959952 10:11298974-11298996 CCTAATTTTTAAAGGAAAGGTGG - Intronic
1064651677 10:17516001-17516023 CCTTATAAAAAGAGGAAGGGAGG - Intergenic
1064704676 10:18059555-18059577 AATTATTATCAGAGGAAAGGAGG - Intergenic
1064726772 10:18288061-18288083 CCTTATAAAAAGAGGAAAGTTGG - Intronic
1065242910 10:23726003-23726025 CCTTTTTGAGTGAGGAAAGGGGG - Intronic
1065783876 10:29194977-29194999 CCATATTCAGAGGGGAAAGGAGG + Intergenic
1066035382 10:31476526-31476548 CCTTATCTACAAAGGAGAGCAGG + Intronic
1066678590 10:37914213-37914235 TGTTATTTCCAGAGGAAAGGAGG + Intergenic
1067094088 10:43286873-43286895 CCCATTTTACAGAGGACAGGGGG + Intergenic
1067671382 10:48325268-48325290 TCTTCTTAACAGAGGAAAGCTGG - Intronic
1068701694 10:60026666-60026688 CCTTATTTACAGAGGAAAGGAGG + Exonic
1068715441 10:60182616-60182638 CCTATTTGTCAGAGGAAAGGAGG + Intronic
1069182724 10:65383309-65383331 CCTTATCCACAGAGGATATGTGG - Intergenic
1070295375 10:75156480-75156502 ACTTAATTACAGAGGGAATGAGG + Intronic
1072016538 10:91352656-91352678 CCCTATTTGCAGAGGCCAGGAGG - Intergenic
1072780054 10:98244079-98244101 TCTTATTTACAGAGAGAAAGCGG + Exonic
1073857655 10:107696142-107696164 CCTTATTTACAGAGAGAAGAGGG + Intergenic
1074047004 10:109848408-109848430 CCATATTTAGGGAGAAAAGGTGG - Intergenic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1075638312 10:124045786-124045808 TATTATTTACAGAGGATTGGTGG + Exonic
1076394901 10:130131245-130131267 CAGTTTTTACAGAGAAAAGGTGG - Intergenic
1078056058 11:8009869-8009891 CCTTATTGACAAAGAAAAGATGG - Intergenic
1078583814 11:12562315-12562337 CCTTATTTATAAAGTCAAGGTGG + Intergenic
1079914748 11:26354742-26354764 ACTTATTTACTGAGGAAACAAGG - Intronic
1082615383 11:55353941-55353963 CCTTATTAACAAAGGGAAGCTGG - Intergenic
1085875638 11:80403779-80403801 CGTAATTTATACAGGAAAGGGGG - Intergenic
1086151770 11:83619468-83619490 CCATATTTACACAGCAAAGAAGG - Intronic
1086312594 11:85550886-85550908 CCGTATTTCCAAAGGAAAGAAGG + Intronic
1087137493 11:94735404-94735426 CCTCATTTACTGAGGAACGAGGG + Intronic
1087965112 11:104403295-104403317 CCTTATTTACTGGGGGAGGGGGG + Intergenic
1088545612 11:110955892-110955914 CCCTATCTACAGAGGTTAGGAGG + Intergenic
1088608244 11:111551911-111551933 CCATATTTACAAAGGGAAAGGGG - Intronic
1089308734 11:117543986-117544008 CCTTCCTTGCAGAGGAAATGGGG - Intronic
1089875723 11:121719951-121719973 CCTTATTTGCAGTTGAATGGAGG - Intergenic
1090000222 11:122949784-122949806 CCTTACTTACAGTGGAACCGGGG - Intronic
1091692671 12:2607591-2607613 CTGTATTTACAGTGGAAAGTAGG + Intronic
1092027844 12:5257989-5258011 CCTTATTCCCAGGGGAAGGGAGG + Intergenic
1092672924 12:10883532-10883554 ACATATTTACAGATGAAAGAGGG - Intronic
1092676804 12:10929936-10929958 ACATATTTACAGATGAAAGAGGG + Intronic
1093069563 12:14694591-14694613 CCTTATTTACCGAGGCAGTGTGG - Intronic
1093318624 12:17683846-17683868 TCTTACATACAGAGGAAAGGTGG - Intergenic
1093829683 12:23740085-23740107 GGTTATTTACAGAGAAATGGTGG - Intronic
1094603251 12:31929108-31929130 CCTTTTTAACAAAGGAAAGAGGG + Intergenic
1094737992 12:33257110-33257132 CAATATTTAAAGAGGAAAAGTGG + Intergenic
1096042666 12:48531667-48531689 CCTTCTTCAAAGAAGAAAGGTGG - Intergenic
1097432658 12:59528967-59528989 CCTTATATCCAGAGGGAAAGAGG + Intergenic
1098856917 12:75663480-75663502 CCTTATTTACAAAGTTCAGGTGG - Intergenic
1101013425 12:100474719-100474741 CCTTATTGACAGAGTGAATGGGG + Intronic
1101027906 12:100631556-100631578 CCTGTTTTAGAGAGGAGAGGAGG + Intergenic
1101319807 12:103663647-103663669 CCTTATAAAAAGAGGAGAGGTGG - Intronic
1101643494 12:106606229-106606251 CCTTAGTTCCTGATGAAAGGGGG + Intronic
1104438819 12:128778511-128778533 GCTAATTTATAAAGGAAAGGAGG + Intergenic
1104866560 12:131959412-131959434 CAGTATCTACAGGGGAAAGGAGG - Intronic
1105673577 13:22645812-22645834 CCTTATACAAAGAGGAAATGAGG - Intergenic
1105959143 13:25313186-25313208 CCCTATTTAGAGAGCAAAGCAGG + Intronic
1107623100 13:42253779-42253801 AGTTATTTACAAAGGAAAGGTGG + Intronic
1108145391 13:47471380-47471402 CCTTCTTCAGAGGGGAAAGGAGG + Intergenic
1108348267 13:49566827-49566849 TCTTATTTTCAGAGGAGAGAAGG - Intronic
1109314776 13:60737145-60737167 CCTTATTTAAAGACGAATTGGGG + Intergenic
1109747088 13:66639123-66639145 CAGTATTTTCAGAGGAAATGGGG + Intronic
1111014558 13:82361762-82361784 CCTTATTTACTTACCAAAGGAGG - Intergenic
1111084163 13:83351925-83351947 CCTTAAGAACAGAGGAAAGTAGG - Intergenic
1112614217 13:100986949-100986971 CCTTCCTTACAGAGGACAGCTGG + Intergenic
1115654142 14:35427004-35427026 CCTTTTATACAGTGGAAATGTGG + Intergenic
1116427125 14:44804990-44805012 CCTTATAAAAAGAGGAAATGTGG + Intergenic
1119105053 14:71915864-71915886 CCTTATAAGCAGAGGAAATGTGG + Intergenic
1120057392 14:79940623-79940645 CCTTACCTACAGAGGAACGAAGG - Intergenic
1121111664 14:91317080-91317102 CCTTATTTTTAGAGGAAGAGGGG - Intronic
1121800417 14:96769693-96769715 CCTTATAAAAAGAGGAAACGTGG - Intergenic
1122175954 14:99919234-99919256 GCTTTTTTAGAGAGGAAGGGTGG - Intronic
1125721264 15:41846186-41846208 CCTTGTCTACACAGGCAAGGTGG - Exonic
1127064095 15:55219111-55219133 CTTTATTCACAGAGGATAGTTGG - Intronic
1130072560 15:80660350-80660372 CTCTATTTCCAGAGGAAAGGAGG + Intergenic
1131489997 15:92854390-92854412 CCTTATTTTTTGAGGAAATGTGG + Intergenic
1131975241 15:97938903-97938925 CCTGGTATACAGAGGAAAGGAGG - Intergenic
1133302347 16:4790350-4790372 CCGTATTCACAGAAGAAAGGTGG + Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133547971 16:6826344-6826366 TCTTATTTACAGAAAAAGGGAGG + Intronic
1133892057 16:9888871-9888893 CCACATTAACAGAGTAAAGGGGG - Intronic
1134857021 16:17528386-17528408 CTCTACCTACAGAGGAAAGGAGG - Intergenic
1138528290 16:57621136-57621158 CCTAATTAACAGAGGGAATGTGG - Intronic
1138664801 16:58556897-58556919 CCTTTTGTACAGAGGAAACTGGG - Exonic
1141913045 16:87073303-87073325 CATTATTTACAGATGAAGGACGG - Intergenic
1143956412 17:10673542-10673564 TCTTAGTTACAGAAGAAAGTGGG - Exonic
1144401469 17:14906936-14906958 CTTTATTTAAAGAGAATAGGAGG + Intergenic
1144891800 17:18498621-18498643 CCTGTTTTACAGAGGGAAGGGGG - Intergenic
1145140422 17:20445696-20445718 CCTGTTTTACAGAGGGAAGGGGG + Intergenic
1145809883 17:27758306-27758328 CCCCTTTTACAGAGGGAAGGGGG - Intronic
1145935091 17:28710688-28710710 CTTTAGTTCCAGAGGACAGGAGG + Intronic
1149299035 17:55287257-55287279 TCTTATTTACAAGGGGAAGGGGG - Intronic
1149940977 17:60866017-60866039 CCATATTCACAGAAAAAAGGGGG - Intronic
1152823525 17:82449472-82449494 CCTTCCTTACACAGGAAACGGGG - Exonic
1153092886 18:1368786-1368808 CCTAATTTAGAGAGCAAAGCAGG - Intergenic
1153854428 18:9131928-9131950 GCATGTTTACAGATGAAAGGGGG + Intronic
1154191664 18:12235549-12235571 CCATTTTAACAGAGAAAAGGGGG + Intergenic
1155845609 18:30702286-30702308 CCTTCTTTACAAGGGAAATGAGG - Intergenic
1156410993 18:36828534-36828556 CCGTTGTTACAGAGGAAAGTGGG - Intronic
1156572885 18:38279179-38279201 CTTTGTTTCCACAGGAAAGGAGG - Intergenic
1157146790 18:45171618-45171640 CCTCATTTACAGATGAAAAAGGG + Intergenic
1158183143 18:54740893-54740915 TTTTATTAACAGAAGAAAGGAGG + Intronic
1158510452 18:58085605-58085627 CCTTATTTATAGAAGAAAGAGGG + Intronic
1159292793 18:66444025-66444047 AGTTATTTAGAGAGCAAAGGCGG - Intergenic
1160901292 19:1430003-1430025 CCTTGTTTATAGAGCAAAGGCGG + Intronic
1162272872 19:9630568-9630590 CCCTATTTACAGAGGAAAGCAGG + Intronic
1164139943 19:22450558-22450580 CCTTATTTACAGATTCTAGGTGG - Intronic
1165244024 19:34487647-34487669 CTTTGTTGACTGAGGAAAGGCGG + Intronic
1166202903 19:41250080-41250102 CCTTTTTTCCAGATGACAGGTGG - Intronic
1168439882 19:56355041-56355063 CCTGAATTTCAGAGGAAATGTGG + Intronic
925048007 2:789252-789274 TCTTATGTCCAGGGGAAAGGAGG - Intergenic
925275896 2:2648091-2648113 TCTTGTCTACAGAGGAAATGGGG + Intergenic
928029628 2:27767486-27767508 CCTTTTTTGAAGAAGAAAGGAGG - Intergenic
929304725 2:40348025-40348047 CTTTATTTACTGAAGGAAGGAGG + Intronic
931014200 2:57956700-57956722 CCTTATTTGGAGAAGAAAGTAGG + Intronic
931097163 2:58954079-58954101 ACTTATTCACATAGGAAAAGAGG - Intergenic
933260119 2:80123044-80123066 ACTTATCCCCAGAGGAAAGGAGG - Intronic
933674575 2:85042973-85042995 CCTTATTTCCTGAAGAAATGGGG - Intronic
936483883 2:112910287-112910309 CCTGTTTTACAGACAAAAGGTGG - Intergenic
936506466 2:113111832-113111854 CCTTACTTGCAGAGGCAAAGAGG + Intronic
937948316 2:127362721-127362743 CCGTTTTTACAGAGGAACCGTGG - Intronic
938118368 2:128617381-128617403 CCAAATTCAGAGAGGAAAGGCGG + Intergenic
938759419 2:134410801-134410823 CCTGATTTTCAGAGGTCAGGAGG + Intronic
939164620 2:138627171-138627193 CCCTCTTTACAGAGCAAAGTGGG - Intergenic
939254932 2:139730601-139730623 CAATATTTAAAGAGGAAAAGTGG - Intergenic
942204282 2:173604012-173604034 CCTAATTTCCACAGGAAATGAGG + Intergenic
945026670 2:205626065-205626087 CATTATTTAGAGAGTAAAGAGGG + Intergenic
947625332 2:231614983-231615005 CCTTACTGACAGCGGGAAGGGGG - Intergenic
948707735 2:239805509-239805531 CCATATTTTAAGAGGAAAAGGGG + Intergenic
1169842612 20:9956565-9956587 CCTTATTTACAACGCAATGGTGG + Intergenic
1170795917 20:19546607-19546629 CCTTTTTTTGAGGGGAAAGGGGG + Intronic
1170875569 20:20246872-20246894 TCTTTTTCACAGAGGAAAGAGGG - Intronic
1172046069 20:32081143-32081165 CCTTATGGAGGGAGGAAAGGAGG - Intronic
1174057355 20:47807300-47807322 CTCTACTTACAGAGGAACGGAGG - Intergenic
1175735348 20:61382359-61382381 CCTTATGCCAAGAGGAAAGGTGG + Intronic
1177214516 21:18110928-18110950 CCCTATTTACAGAGTAACTGAGG - Intronic
1177593272 21:23201641-23201663 CCTTATATTTAGATGAAAGGTGG + Intergenic
1179718871 21:43304289-43304311 CCTTATAAAGAGAGGACAGGTGG + Intergenic
1179968933 21:44823533-44823555 CAGTATTTAAAGAGGAAAAGTGG - Intergenic
1181548956 22:23625128-23625150 CCTAATTTAAAGAGGAAAACTGG + Intronic
1182515639 22:30857282-30857304 CCTTGTTTACAGAGAAATGTGGG + Intronic
1183075907 22:35426601-35426623 CCCTTTCTACAGATGAAAGGAGG - Intergenic
1184436181 22:44478799-44478821 CCTTATCTTCAGAGAAATGGTGG + Intergenic
1185379334 22:50500541-50500563 CACTATTCACATAGGAAAGGCGG + Intergenic
949913354 3:8934784-8934806 CATTATTAATAGAGGAAAAGTGG + Intronic
951081768 3:18458585-18458607 AATTATTTCCAGAGGAAAGGGGG - Intergenic
953138427 3:40204655-40204677 GATTATTTACCTAGGAAAGGCGG - Intronic
953709063 3:45254660-45254682 TCCCATTCACAGAGGAAAGGAGG - Intergenic
957379263 3:79404351-79404373 CCATATGTACAAAGGACAGGAGG - Intronic
957649288 3:82978655-82978677 GCCTCTGTACAGAGGAAAGGAGG - Intergenic
957717368 3:83946091-83946113 CCTTATATAGAGAGGTAAGATGG + Intergenic
962694277 3:137932193-137932215 CATTATTTGGACAGGAAAGGAGG + Intergenic
965399235 3:168198222-168198244 CCTAATATACAGGGGAAAAGAGG - Intergenic
967654346 3:192028596-192028618 CCTTATTTATAGAGGAAAAAAGG + Intergenic
968180280 3:196590081-196590103 TTTTATTTATACAGGAAAGGGGG - Intergenic
968360274 3:198142168-198142190 CCTCATTTACAGGTGAAATGAGG - Intergenic
969602258 4:8183244-8183266 CCTCGTTTACAGAGGAAGGCCGG + Intronic
969828181 4:9774857-9774879 CCTTATTTGCAGAAGGAATGAGG - Intronic
969962089 4:10954996-10955018 CCTAGTTCACAGAGGAGAGGGGG + Intergenic
969965692 4:10993090-10993112 CTTTATTAAAAGAGGAAATGTGG + Intergenic
970647728 4:18142040-18142062 CCCTATTGACAGAAGAAAGCAGG - Intergenic
970882903 4:20952956-20952978 CCTTATTAAAAGAGGACTGGGGG - Intronic
971307489 4:25496315-25496337 CTTGATTTACAGATGAAATGAGG - Intergenic
971617289 4:28808160-28808182 CAGTAGTTACAGAAGAAAGGAGG + Intergenic
972655584 4:41060560-41060582 CCTCACTCACAGAGGAGAGGAGG + Intronic
973072658 4:45884101-45884123 CCATATTTAAAGGGGAAAAGTGG - Intergenic
973256378 4:48117442-48117464 CCTGATTAACAGAGGAAAATTGG - Intronic
978065624 4:104396388-104396410 CCTTATCTACAGAAGAGAGAGGG - Intergenic
979743120 4:124176556-124176578 CCTTAGTTGCTGAGGCAAGGAGG + Intergenic
979778938 4:124625103-124625125 TCCTATTTACTCAGGAAAGGGGG - Intergenic
980666902 4:135952230-135952252 CCTCATTTCCAGAGGAAAAGTGG + Intergenic
980795852 4:137681568-137681590 CCTCATGTACAGAGGAAAAAGGG + Intergenic
982551226 4:156802085-156802107 CAGTATTTAAAGGGGAAAGGTGG - Intronic
984049252 4:174843410-174843432 CCTTATATAAAGAGGAAATTTGG + Intronic
984567626 4:181349573-181349595 ACTTATTTAAAAAGGGAAGGAGG - Intergenic
984813474 4:183816873-183816895 ACTTCTTTGCAGAGGAAATGGGG + Intergenic
987295284 5:16545017-16545039 CCTTATTTTGAGAGGAAAGCAGG + Intronic
987774796 5:22350594-22350616 CCTTATTTACTAAAGAAAGGTGG + Intronic
988788997 5:34590154-34590176 CCTCTTTTACAGATGAAACGCGG + Intergenic
989160694 5:38387937-38387959 CCTTATATACAAAGTAAGGGAGG + Intronic
989233154 5:39110629-39110651 TTTTATTTAAAGGGGAAAGGAGG - Intronic
989627554 5:43444993-43445015 CCTTATTCTCTGAGGAAAGATGG - Exonic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
992848040 5:80774186-80774208 CCTTATTTGCAGAGCACAGTTGG + Intronic
993375230 5:87142625-87142647 CCTCAGTTACAGAGTAGAGGTGG - Intergenic
996011754 5:118488210-118488232 CCTTATTTAAAAGGGGAAGGAGG + Intergenic
997685218 5:135783727-135783749 CTTAATTTCCAGAGGGAAGGAGG + Intergenic
999827526 5:155288432-155288454 CCATATTTGTGGAGGAAAGGAGG + Intergenic
1000131031 5:158299814-158299836 ACTTCTTTACAGTGGAAAGCAGG + Intergenic
1000839594 5:166201409-166201431 CCTTATGTACAGAGGAACAAAGG - Intergenic
1001160649 5:169309861-169309883 CCTTATACACAAATGAAAGGAGG - Intergenic
1001759076 5:174192751-174192773 TCTTATTTAGAGAGGTTAGGTGG - Intronic
1003723872 6:8736814-8736836 CATTATGGACAGAGGAAAAGAGG - Intergenic
1006518563 6:34558141-34558163 CCTTGTTTACTGAGGAAAAGGGG - Intergenic
1008918881 6:56822098-56822120 TTTTATTTAAAGAGAAAAGGAGG + Intronic
1009362770 6:62835581-62835603 CCTAATTTCCAGAGGGAGGGAGG + Intergenic
1009906541 6:69875921-69875943 CATTATAAAGAGAGGAAAGGAGG + Intronic
1010011007 6:71048160-71048182 CCTTATTTGCAAAACAAAGGTGG + Intergenic
1011580416 6:88857713-88857735 AAATAATTACAGAGGAAAGGAGG + Intronic
1011977757 6:93327090-93327112 ACTGATTTATAGAGTAAAGGTGG - Intronic
1012020732 6:93915699-93915721 CCTTCTTCACAGGGGAAATGGGG - Intergenic
1015104673 6:129521734-129521756 ACTTAATGACAGAGGAAAAGAGG + Intergenic
1015413911 6:132926863-132926885 CCTTATGTACTAAGGAAAGCTGG + Intergenic
1019259723 7:74463-74485 CCTCATTTACAGGTGAAATGAGG + Intergenic
1023153465 7:37224142-37224164 GCTTGCTTACACAGGAAAGGAGG - Intronic
1024997991 7:55289307-55289329 CAGTATTTACAGAGAAAAAGTGG - Intergenic
1026183968 7:68066827-68066849 ACATATTTAGTGAGGAAAGGAGG - Intergenic
1028610089 7:92700976-92700998 CCTTAGTTACAGAAGAAAAGAGG + Intronic
1031390375 7:121206132-121206154 CCTCATTTAAAAAGGAAAAGAGG + Intronic
1032396766 7:131595689-131595711 CAATATTTAAAGAGGAAAAGCGG + Intergenic
1033965046 7:146965135-146965157 CCATGTGTACAGAGGAGAGGGGG + Intronic
1038067558 8:23978895-23978917 ACTTATACACAGAGGGAAGGAGG - Intergenic
1038637782 8:29301356-29301378 CCTAATTTTCAGAGGAACAGAGG - Intergenic
1039608161 8:38899993-38900015 CGGTGTTAACAGAGGAAAGGCGG - Intergenic
1040484526 8:47857480-47857502 CCTTATTAAAAGAGGAAATCAGG + Intronic
1042854665 8:73254460-73254482 CCTTTTTTACAGAATAAAAGTGG - Intronic
1044215724 8:89607897-89607919 CCTTATTTCTAGAGTAAAGGAGG + Intergenic
1044754210 8:95444922-95444944 CCTTCTTTAGAGAGGAAGGCAGG + Intergenic
1045926326 8:107581664-107581686 CCTAATATCCAGAGGAAAAGAGG + Intergenic
1046784511 8:118251745-118251767 CCTAATTCACAGCTGAAAGGGGG + Intronic
1048509071 8:135045977-135045999 GCTTATTTTCAGAGAAGAGGAGG + Intergenic
1048838250 8:138541801-138541823 CATTATTTACAGATGAATGATGG + Intergenic
1057136230 9:92690136-92690158 CCTTACCTACAGAGGAACAGAGG - Intergenic
1058702660 9:107613703-107613725 CCTTATTGACAGAGAAATGGGGG + Intergenic
1059376502 9:113885805-113885827 CCTTTCTTAAAAAGGAAAGGAGG + Intronic
1060152144 9:121295628-121295650 CCAAGGTTACAGAGGAAAGGAGG + Intronic
1061641557 9:131961581-131961603 CATTATTTACAGTGGAAATCTGG - Intronic
1062744974 9:138205996-138206018 CCTCATTTACAGGTGAAATGAGG - Intergenic
1185836634 X:3350783-3350805 CCACATTTCTAGAGGAAAGGGGG - Intergenic
1186530163 X:10287178-10287200 GCTTATTTTCAGGAGAAAGGTGG + Intergenic
1186975521 X:14898780-14898802 CCTTATTTACAAATTAAAGATGG - Intronic
1188440455 X:30210757-30210779 CGGTATTTAAAGAGGAAAAGGGG - Intergenic
1189108764 X:38265082-38265104 CCTTATAAAAAGAGGAAATGTGG + Intronic
1189887556 X:45563671-45563693 GGTTATTTACAGTGGAATGGGGG + Intergenic
1189953453 X:46255676-46255698 CCTTATTTATAGAGGCCAGTTGG + Intergenic
1191776711 X:64822352-64822374 CCTTATTCAAAGAGGAAATTTGG + Intergenic
1193256685 X:79356649-79356671 CCTTATATAAAGAGTAATGGTGG + Intergenic
1194494543 X:94596419-94596441 CCATATTGACAGGGGAAAAGAGG - Intergenic
1197466354 X:126808183-126808205 GGTTATTTACAAAGGAAAAGAGG - Intergenic
1197831978 X:130652730-130652752 CCTTATTGACAGAGGAAATTTGG + Intronic
1198610175 X:138390272-138390294 ACATACTTACAGAAGAAAGGAGG - Intergenic
1199753032 X:150839265-150839287 TATGATTTACAGTGGAAAGGCGG - Intronic