ID: 1068703159

View in Genome Browser
Species Human (GRCh38)
Location 10:60041831-60041853
Sequence ACTGGTATGCAGAGTGCTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 182}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068703159_1068703162 -8 Left 1068703159 10:60041831-60041853 CCCTCAGCACTCTGCATACCAGT 0: 1
1: 0
2: 3
3: 11
4: 182
Right 1068703162 10:60041846-60041868 ATACCAGTATTCTGGCAAGCAGG No data
1068703159_1068703163 -7 Left 1068703159 10:60041831-60041853 CCCTCAGCACTCTGCATACCAGT 0: 1
1: 0
2: 3
3: 11
4: 182
Right 1068703163 10:60041847-60041869 TACCAGTATTCTGGCAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068703159 Original CRISPR ACTGGTATGCAGAGTGCTGA GGG (reversed) Intronic
900074934 1:806484-806506 ATTGGGATGGAGAGGGCTGAAGG + Intergenic
900387374 1:2416750-2416772 ACAGGGGTGCAGAGTGCAGAGGG + Intergenic
900821704 1:4894715-4894737 GCGGGTATGCAGAGTGCTGCTGG - Intergenic
900955844 1:5885872-5885894 ACTGATGCGCAGAGTGCTGCGGG + Intronic
902528243 1:17073439-17073461 ACGGATATAGAGAGTGCTGATGG + Intronic
902921298 1:19667276-19667298 ACAGGGATGGAGAGTGCAGATGG - Intronic
903118156 1:21195270-21195292 CCTGGGATGCAGACAGCTGAAGG - Intergenic
903128137 1:21261562-21261584 ACAGGTATGCAGAGCGGTGAGGG - Intronic
906319182 1:44806140-44806162 GCTGGTATGCAGTGTGGTGCTGG - Exonic
906632210 1:47380946-47380968 CCTGTTGTGCAGAGAGCTGATGG + Intergenic
907709784 1:56868718-56868740 AGTGGTATGCCGAGTGGGGAAGG - Intronic
908062766 1:60369736-60369758 ACTGGTATGTTGTGTGCTGGGGG - Intergenic
912406281 1:109440828-109440850 ACTGATATGGAGAAGGCTGAAGG - Intergenic
914973696 1:152336018-152336040 ATTGATATCCTGAGTGCTGATGG - Intergenic
915703688 1:157823055-157823077 ACTGGAATTCAGACTGCTGGTGG - Intergenic
920430014 1:205912736-205912758 AAAGGTATGCAGAGGGATGATGG + Intergenic
920712204 1:208306086-208306108 ACAGGTAAGCAGAGACCTGAAGG + Intergenic
922270778 1:224031389-224031411 ATTGGGATGGAGAGGGCTGAAGG + Intergenic
922346550 1:224701162-224701184 ACTGCTATGCAGAGAGTGGAAGG + Intronic
1063214634 10:3913070-3913092 AGTGGTAGGCAGTGTGCTGAGGG - Intergenic
1063987935 10:11527097-11527119 GCAGGTGTACAGAGTGCTGAGGG + Intronic
1065434495 10:25693012-25693034 GCTGGTGAGCAAAGTGCTGAGGG - Intergenic
1068703159 10:60041831-60041853 ACTGGTATGCAGAGTGCTGAGGG - Intronic
1069238699 10:66111087-66111109 ATTGTTATCCACAGTGCTGAGGG + Intronic
1069736266 10:70656726-70656748 GCTGGGATGCAGAGAGCGGAAGG + Intergenic
1069882429 10:71602099-71602121 TCTGGGCTGCAGAGTCCTGACGG + Intronic
1070542844 10:77429179-77429201 ACTGGTATGCCAAGTTCGGAAGG + Intronic
1071571973 10:86702232-86702254 ATTGGTATTGACAGTGCTGAAGG - Intronic
1072752814 10:97995523-97995545 AATGGTATGCAGACCTCTGAAGG + Intronic
1072948916 10:99835542-99835564 GGAGGTATGCAGAGTGCTGAGGG - Intronic
1074150750 10:110757777-110757799 TCTGGGAGGCTGAGTGCTGACGG - Intronic
1074972760 10:118553019-118553041 ACTGGTATCCAGAGTGTATAAGG - Intergenic
1075680286 10:124326345-124326367 ACCTGTATGGAGAGTGATGATGG + Intergenic
1076302715 10:129440199-129440221 GCTGGGATGCTGAGTTCTGATGG - Intergenic
1078009320 11:7559549-7559571 AGTGGTATGCAGAGGCCTGTAGG + Intronic
1078579906 11:12531022-12531044 AATTGTATGCAGATTGATGAAGG + Intergenic
1079272086 11:18998129-18998151 ACTGGCATTTAAAGTGCTGAAGG - Intergenic
1079466755 11:20738309-20738331 ACAGGAGTGCACAGTGCTGAGGG + Intronic
1079479968 11:20869423-20869445 CCTAGTATTCAAAGTGCTGATGG + Intronic
1079987048 11:27210413-27210435 ATGGGTTTGCACAGTGCTGAGGG + Intergenic
1080943254 11:36943059-36943081 GCTGGAAGGCAGAGTGATGAAGG + Intergenic
1084237539 11:67797681-67797703 GCTGGATTGCAGATTGCTGACGG + Intergenic
1084298191 11:68226643-68226665 ACAGGGATGCTGAGTGTTGACGG - Intergenic
1087900042 11:103630340-103630362 ACTGGTATCCTGAGTGCTGTTGG + Intergenic
1090366300 11:126209502-126209524 ACTGGTATGAGGCCTGCTGATGG - Exonic
1092408209 12:8235274-8235296 GCTGGAAGGCAGAGAGCTGATGG + Intergenic
1095912130 12:47438919-47438941 ACTGGTATGCAACGTACTGTTGG + Intergenic
1096739226 12:53679871-53679893 ACTGGTATCCAGGCTTCTGAGGG + Intergenic
1098088197 12:66871183-66871205 TCTGGAATGCAGACTGTTGAAGG + Intergenic
1101835862 12:108295071-108295093 ACTGGAATGCAGAGAGAAGATGG + Intronic
1103226399 12:119291663-119291685 ACTGATATGGTGAATGCTGACGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106644120 13:31614497-31614519 AGAGGTAGGCAGAGTGCTAAAGG - Intergenic
1107636607 13:42398550-42398572 ACTGATATCCAGGGTCCTGATGG + Intergenic
1111370748 13:87313501-87313523 ACTGTAATGCTCAGTGCTGAAGG + Intergenic
1114994188 14:28327251-28327273 GATGATATGCAAAGTGCTGAAGG - Intergenic
1115400079 14:32947417-32947439 ACTAGTATGTATTGTGCTGATGG + Intronic
1116666399 14:47781300-47781322 ACTGGTATTCAAAGTGAGGATGG - Intergenic
1119547924 14:75486637-75486659 ACTGGGATGCAGAGTGGGGTTGG + Intergenic
1120407709 14:84109621-84109643 ACTGTTATGCAGAATGCATAAGG - Intergenic
1120699890 14:87687494-87687516 ACTGGTAACCAGAGAGCTAACGG - Intergenic
1120838782 14:89064677-89064699 ACAGGGCTGCAGAGTGCAGAAGG + Intergenic
1124235339 15:27984922-27984944 ACTGGAATGCAGTGAGCTGTGGG + Intronic
1125826600 15:42681898-42681920 ACTGCTGTGCTGAGTCCTGAGGG + Intronic
1128282806 15:66410559-66410581 GCAGGTATCCAGACTGCTGAAGG + Intronic
1130826752 15:87556745-87556767 ACTGCCTGGCAGAGTGCTGAAGG - Intergenic
1133349165 16:5090105-5090127 GCTGGAAGGCAGAGAGCTGATGG + Exonic
1133659388 16:7901586-7901608 ACTACTCTGCAGAGTGCTCACGG - Intergenic
1134249606 16:12565289-12565311 ACTTGAATGGAGAGTGCTGGTGG - Intronic
1138414769 16:56865297-56865319 ACTGCTCAGCAGTGTGCTGATGG - Exonic
1138477300 16:57279294-57279316 GGTGGCATGGAGAGTGCTGATGG - Intronic
1139829152 16:69782436-69782458 ACTGGTATCCCCAGAGCTGAGGG + Intronic
1142161321 16:88559080-88559102 GCTGGGAAGCAGGGTGCTGATGG - Intergenic
1142852049 17:2709020-2709042 GCGTGTATGCAGAGTGCTGTTGG - Intronic
1147712946 17:42483128-42483150 AATGGTATGCAGAAGGCTGGAGG + Exonic
1148970720 17:51478890-51478912 ACTGGTATTGAGTGTGCTGGGGG - Intergenic
1152759684 17:82101356-82101378 ACTGGTGTGCAGATGGCTGTGGG + Intergenic
1153258668 18:3199230-3199252 ACTGTTATTCACAGTGCTGCTGG - Intronic
1158788074 18:60740175-60740197 AGAGGTATGCAGAGAGCTGGAGG - Intergenic
1164922295 19:32097537-32097559 TCTGGGATGCAGAGGGCTGGGGG - Intergenic
1167054696 19:47102484-47102506 ACTGGGGTGCAGAGTGTTTAAGG - Intronic
924968532 2:101111-101133 CCTGGGTTGCAGAGTCCTGATGG - Intergenic
927481373 2:23456874-23456896 GCTGGTTTGAAGTGTGCTGACGG + Intronic
932194363 2:69770352-69770374 ACTGGTCTGCAGATTGCAAAGGG - Intronic
932461148 2:71882789-71882811 TCTGGGATGCAGGGTGCTGGTGG + Intergenic
934935072 2:98459413-98459435 GCTGGCGTGCAGAGTGCTGAGGG + Intronic
935467953 2:103421613-103421635 AATGATATGCTTAGTGCTGACGG + Intergenic
937234230 2:120420788-120420810 ACTGGTGGGCAGTGTGCTGGGGG - Intergenic
939034926 2:137119585-137119607 ACTGGTGTGAAGAGAGCTCAGGG + Intronic
940524712 2:154798870-154798892 ACTGTTATGAATAGTACTGATGG + Intronic
942759774 2:179384393-179384415 TCTGGGATGAAGAGTTCTGAGGG - Intergenic
944581028 2:201133017-201133039 TCTGGTTTGCAGAGTGCTGATGG + Exonic
944721720 2:202429363-202429385 ACTGGAATGCAGAGTGGGAAAGG - Intronic
945437330 2:209834075-209834097 ACTGTCAAGCAGAGCGCTGAGGG - Exonic
945453009 2:210015344-210015366 AGTGGCCTGCAGAATGCTGAAGG + Intronic
947910882 2:233799944-233799966 AATGGTTTCCACAGTGCTGAGGG + Intronic
947912825 2:233812592-233812614 AATGATATGCTGAGTACTGAAGG + Intronic
949082788 2:242118300-242118322 ATTGGGATGGAGAGGGCTGAAGG - Intergenic
1170119260 20:12894135-12894157 GCTGATATGCAGAGTGCTGAGGG - Intergenic
1170160410 20:13304503-13304525 ACAGATATGGAAAGTGCTGAGGG - Intergenic
1172106728 20:32521618-32521640 ACAGGGATGCAGAGGGCTGGGGG + Intronic
1173201516 20:40958682-40958704 TCTGGTGTGTAGAGTGCTAAAGG - Intergenic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1183177948 22:36238041-36238063 TCTGGAAAGCAGAGTGCTCAGGG - Intronic
1183717687 22:39543418-39543440 AGTGGTATACAGAGTTCTGCAGG + Intergenic
1183964801 22:41435247-41435269 ACTGGTTTGCAGACTGTGGAAGG - Exonic
1184243750 22:43225298-43225320 AGAGCTATGCTGAGTGCTGAAGG + Intronic
1184552750 22:45213287-45213309 ACTGTTGGGCAGAGGGCTGAGGG - Intronic
1184596744 22:45518533-45518555 ACTGGTTTGCAGAGTGACTAAGG + Intronic
1184751236 22:46487807-46487829 AAGGGTATCCAAAGTGCTGAAGG + Intronic
950101624 3:10360273-10360295 CCTGGGATGCAGAGCCCTGAGGG - Intronic
950270951 3:11614457-11614479 ACTGGCATACAGAGTGCTGAAGG + Intronic
950710782 3:14811339-14811361 TCCGGTATGCCGAGTACTGAAGG - Intergenic
952191698 3:31029616-31029638 ACTGGCATGCAGTGGGCTGCAGG - Intergenic
952600499 3:35075444-35075466 AGTGGTATGAAGAGTGATCATGG - Intergenic
953715413 3:45313184-45313206 GCTGGTATGGAGGGTGCTGTAGG - Intergenic
955105951 3:55898196-55898218 TCTGGAATGAAGAGTGCTCAAGG - Intronic
955539017 3:59954495-59954517 AGTGCTGTGCAAAGTGCTGAAGG + Intronic
955829380 3:62985029-62985051 AAGGGTAAGCAGAGTCCTGAGGG - Intergenic
956890967 3:73613731-73613753 CCTGGGATGCAGGGTGCAGAAGG + Intronic
957053491 3:75427448-75427470 GCTGGAAGGCAGAGAGCTGATGG + Intergenic
960026124 3:113012561-113012583 ATTGGGAAGCCGAGTGCTGATGG - Intronic
961887144 3:130103762-130103784 GCTGGAAGGCAGAGAGCTGATGG + Intronic
962419747 3:135217308-135217330 AGTGCTATGCAGAGTCCTCATGG + Intronic
965661352 3:171045435-171045457 GCTGATTTGCAGGGTGCTGAGGG + Intergenic
968976421 4:3824480-3824502 AGTGCCATGGAGAGTGCTGAGGG - Intergenic
969757700 4:9160927-9160949 GCTGGAAGGCAGAGAGCTGATGG - Intergenic
969817678 4:9698440-9698462 GCTGGAAGGCAGAGAGCTGATGG - Intergenic
971299683 4:25431481-25431503 ACTGGCAGGCACAGTTCTGAAGG + Intergenic
971311616 4:25530137-25530159 AGGGCTATGCAGTGTGCTGAGGG - Intergenic
977292344 4:95177624-95177646 CATGGTATGCACAGTGCTGTTGG + Intronic
979837731 4:125393675-125393697 CCTGGTATTCAGCTTGCTGAAGG - Intronic
979975462 4:127190684-127190706 ACTGGGACGCAGACTGCTAATGG - Intergenic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
985218288 4:187675895-187675917 AATGGGATGCAGAGTGCTGCTGG + Intergenic
985929851 5:3048416-3048438 GCTGGGATACACAGTGCTGATGG - Intergenic
989675974 5:43973167-43973189 ACTGGTATGCATAGTTCAGCAGG + Intergenic
992215554 5:74521501-74521523 ACTGCTGTGCATGGTGCTGATGG - Intergenic
994469293 5:100182007-100182029 ACTGCCAGGCTGAGTGCTGAAGG - Intergenic
995582886 5:113619332-113619354 TCTGTTTTACAGAGTGCTGATGG + Intergenic
996523533 5:124452762-124452784 CCTGGTTTGCAGAGTGCAGAGGG + Intergenic
997942205 5:138168451-138168473 ACTGGTATGGAGACTTCTGTGGG - Intronic
998669249 5:144335149-144335171 AATGCTTTGGAGAGTGCTGAAGG - Intronic
998757651 5:145398486-145398508 ACTGGTATGCAGAGGGTTTAGGG - Intergenic
1001015890 5:168140699-168140721 ACAGGTATCCAGAATCCTGAAGG - Intronic
1002017460 5:176336265-176336287 ACTTGTATGCAAAGTGCTAGTGG - Intronic
1006192073 6:32215567-32215589 AATGATATGCAGAGTCCTGCAGG + Intronic
1006439757 6:34046668-34046690 ACAGGGATGGTGAGTGCTGAGGG + Intronic
1006764611 6:36493753-36493775 ACTTAGAGGCAGAGTGCTGATGG - Intergenic
1007033044 6:38646464-38646486 TCAGGTATGCAGTGTCCTGATGG - Intergenic
1008197128 6:48538111-48538133 ATGGGGATGCACAGTGCTGAGGG + Intergenic
1009881304 6:69569651-69569673 ACTGTTGTGGAGAGTGTTGATGG - Intergenic
1011361120 6:86526402-86526424 ACAGGTTTGCAGAGTGGTGTGGG - Intergenic
1012309659 6:97706573-97706595 AATTGTAAGCAGAGTGCAGAAGG - Intergenic
1015010621 6:128342602-128342624 ACTGCTATTCAGGGTGGTGATGG - Intronic
1018846696 6:167561828-167561850 AATGGGATCCAGAGTGCAGAGGG - Intergenic
1020413770 7:7922619-7922641 ATTGCTATGCAGATTGTTGATGG + Intronic
1024929480 7:54655081-54655103 CCTGGTATGCGGAGTGTTGATGG - Intergenic
1026230404 7:68478278-68478300 ACAGGTATCCAAAGTGTTGAAGG - Intergenic
1027137710 7:75637027-75637049 ACTGGAGTGCAGAGTTCAGAAGG - Intronic
1029090600 7:98045134-98045156 CCTTGTGTGCAGAGTGCTGCAGG - Intergenic
1030125554 7:106149647-106149669 ACTGCTTTTCTGAGTGCTGAGGG - Intergenic
1032492376 7:132333296-132333318 ACAGGTATGCAGAGTAATAATGG + Intronic
1034237606 7:149584975-149584997 AGTGGTATCCAGAGGGCTGCAGG - Intergenic
1035540711 8:435000-435022 ATTGGGATGGAGAGGGCTGAAGG - Intronic
1036085010 8:5604067-5604089 ATTGGTATGCAGCTTGCAGAGGG - Intergenic
1036380963 8:8236256-8236278 GCTGGAAGGCAGAGCGCTGATGG - Intergenic
1036848615 8:12186373-12186395 GCTGGAAGGCAGAGAGCTGATGG + Exonic
1036869977 8:12428654-12428676 GCTGGAAGGCAGAGAGCTGATGG + Exonic
1038018301 8:23532839-23532861 ACTGGTAGGAAGGGTGCTGGGGG + Intronic
1038664160 8:29522957-29522979 AATGGTGTGCAGAGTGCAGGAGG + Intergenic
1039114844 8:34081289-34081311 ACAGGAATGCAGATTCCTGAGGG + Intergenic
1040049449 8:42998113-42998135 ACAGAGATGCAGAGTGCTGGGGG - Intronic
1041788512 8:61663410-61663432 ACTGGTCTGGAGCCTGCTGAGGG + Intronic
1046854686 8:119017662-119017684 AGTGGTATGCATAGTGATGTAGG - Intronic
1047706262 8:127502766-127502788 ATTGGTATGCAAAGGGCTGTTGG + Intergenic
1047906678 8:129480159-129480181 ACTGGTGTGCAGTGATCTGACGG + Intergenic
1058396317 9:104557783-104557805 ACTTGTTTGTAGAGTCCTGAGGG - Intergenic
1058424522 9:104864797-104864819 ACTGGTCTGGAGAGTGTTGCAGG - Intronic
1058539792 9:105999764-105999786 ACAGGTCAGCAGAGGGCTGAAGG + Intergenic
1059624743 9:116050843-116050865 ACTGCTATGAAAAGGGCTGATGG + Intergenic
1060055193 9:120407121-120407143 CCTGCTCTGCAGAGTGCTGCTGG + Exonic
1060239482 9:121890507-121890529 ACTTGTAAGCAGAGTGCTTGGGG - Intronic
1061317737 9:129807435-129807457 CCTGGTAAACAAAGTGCTGATGG - Intronic
1061477564 9:130878660-130878682 ACTGGAATGGAGAGAGCTCATGG - Intronic
1189762980 X:44341960-44341982 ACTGGTAATCAGAGTGTTGCTGG + Intronic
1190152292 X:47958408-47958430 ACTGGAATGTACAGAGCTGATGG + Intronic
1191013608 X:55786991-55787013 ACTGGTAAGAAGAGTCCTGGAGG + Intergenic
1191097601 X:56689897-56689919 ACTGGAATAAAGAGTGCTGCTGG + Intergenic
1191109092 X:56791069-56791091 ACTGGAATGCAGAGTGCCTCAGG - Intergenic
1191109926 X:56796317-56796339 ACTGGAATGCAGAGTGCTCCAGG - Intergenic
1191871074 X:65745825-65745847 CCTGGAATGCAAAGTGCTGTGGG - Intergenic
1193198774 X:78663500-78663522 AAAGGTTTGCAGACTGCTGAAGG + Intergenic
1196021175 X:110992521-110992543 AGTGGTAAGGAGAGTTCTGAGGG - Intronic
1196046054 X:111257706-111257728 GCTGAGATGCAGAGTGCAGATGG + Intronic
1201282738 Y:12355355-12355377 CTTGGTTTGCAGAGTTCTGAAGG + Intergenic